ID: 1070379306

View in Genome Browser
Species Human (GRCh38)
Location 10:75866252-75866274
Sequence TGTGCTGTGTGGAGCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 13, 3: 50, 4: 462}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070379306_1070379314 20 Left 1070379306 10:75866252-75866274 CCACCTCTGCTCCACACAGCACA 0: 1
1: 0
2: 13
3: 50
4: 462
Right 1070379314 10:75866295-75866317 GGCTCATCAAAGGTGTTTGTGGG No data
1070379306_1070379313 19 Left 1070379306 10:75866252-75866274 CCACCTCTGCTCCACACAGCACA 0: 1
1: 0
2: 13
3: 50
4: 462
Right 1070379313 10:75866294-75866316 GGGCTCATCAAAGGTGTTTGTGG No data
1070379306_1070379311 -1 Left 1070379306 10:75866252-75866274 CCACCTCTGCTCCACACAGCACA 0: 1
1: 0
2: 13
3: 50
4: 462
Right 1070379311 10:75866274-75866296 AGAATTGTGGCACAGCAAGTGGG No data
1070379306_1070379312 10 Left 1070379306 10:75866252-75866274 CCACCTCTGCTCCACACAGCACA 0: 1
1: 0
2: 13
3: 50
4: 462
Right 1070379312 10:75866285-75866307 ACAGCAAGTGGGCTCATCAAAGG No data
1070379306_1070379316 27 Left 1070379306 10:75866252-75866274 CCACCTCTGCTCCACACAGCACA 0: 1
1: 0
2: 13
3: 50
4: 462
Right 1070379316 10:75866302-75866324 CAAAGGTGTTTGTGGGAGATGGG No data
1070379306_1070379315 26 Left 1070379306 10:75866252-75866274 CCACCTCTGCTCCACACAGCACA 0: 1
1: 0
2: 13
3: 50
4: 462
Right 1070379315 10:75866301-75866323 TCAAAGGTGTTTGTGGGAGATGG No data
1070379306_1070379310 -2 Left 1070379306 10:75866252-75866274 CCACCTCTGCTCCACACAGCACA 0: 1
1: 0
2: 13
3: 50
4: 462
Right 1070379310 10:75866273-75866295 CAGAATTGTGGCACAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070379306 Original CRISPR TGTGCTGTGTGGAGCAGAGG TGG (reversed) Intronic
900124030 1:1061729-1061751 TGCCCTTTGTGGGGCAGAGGGGG + Intergenic
900580090 1:3404548-3404570 CGGGCTGTGAGGGGCAGAGGCGG - Intronic
900642990 1:3696164-3696186 AGTCCTGTGTGCATCAGAGGAGG + Intronic
900648507 1:3719679-3719701 GATGCTGTGGGGAGCAAAGGGGG + Intronic
900853666 1:5163467-5163489 TGAGCTGTGTTTAGCAGAAGTGG - Intergenic
900867743 1:5280485-5280507 AGTGCTTTGTAGGGCAGAGGAGG + Intergenic
900911405 1:5599356-5599378 TTTGCTGTGGGGAGTTGAGGTGG - Intergenic
900998184 1:6134084-6134106 TGTGGGGTGTGGAGCCGGGGCGG + Intronic
901132204 1:6969065-6969087 TGTGGTGAGTGGACCAGAAGAGG + Intronic
901645613 1:10715461-10715483 GGTGCTGTGGGGAGTGGAGGAGG - Intronic
901645811 1:10716193-10716215 GGTGCTGTGGGGAGCAGATTGGG - Intronic
901822042 1:11836545-11836567 TGTGCTGTGGGGAGCAGTGCAGG + Intronic
902754186 1:18538195-18538217 TGAGCTCTCTGGAGCAGAGAAGG - Intergenic
903463185 1:23533601-23533623 AGTGTTGTGAGGATCAGAGGAGG - Intergenic
903558588 1:24211079-24211101 AGGGCTTTGTGGAGGAGAGGAGG - Intergenic
903849433 1:26297193-26297215 TCTGAAGTGTGGAGGAGAGGAGG - Intronic
904562969 1:31411102-31411124 TGTGCTCTGGGTAGGAGAGGGGG + Intronic
905127437 1:35725543-35725565 TGGGGTGGGTGGAGGAGAGGTGG - Intronic
905173384 1:36122300-36122322 TGTGCTGTGTGGAGATGAGCTGG - Intronic
906064444 1:42970250-42970272 TCTGCTGTGTGGGGCAGAACAGG - Intergenic
906274889 1:44508125-44508147 AAAGCTGTGTGGAGCAGAGGAGG + Intronic
906524920 1:46488386-46488408 TGTGCTGGGTGGGGCAGAAGGGG - Intergenic
906645446 1:47471256-47471278 TCTGCTCTGTGGCTCAGAGGAGG - Intergenic
907050511 1:51326912-51326934 TGGGCTGGATGGAGCAGAGCTGG + Intronic
907319290 1:53592722-53592744 TCTGGTGTGTGGAGCAGTGGTGG - Intronic
907473281 1:54688649-54688671 TGTGCTGTGAGGACCAGATAGGG + Intronic
907666439 1:56437275-56437297 TCTGCTGTGTGGGGGAGGGGAGG - Intergenic
907701989 1:56797605-56797627 TGTGCTTTGGGGAGCAGCTGTGG + Intronic
907792808 1:57683392-57683414 TGTGCTGTGTGGTGGAGGGTGGG - Intronic
907800996 1:57765700-57765722 TGTGCTGTATGGAGGAGGAGTGG - Intronic
908159667 1:61394175-61394197 TGTCTTGGGTGGGGCAGAGGGGG - Intronic
908673860 1:66578916-66578938 TGTACTTTGGGGAGCAGAGGAGG - Intronic
908931498 1:69321527-69321549 CTTCCTGTGTGCAGCAGAGGTGG + Intergenic
910163632 1:84299472-84299494 TGTGGTGTGTGGGGGTGAGGGGG - Intronic
910292391 1:85612154-85612176 TGTGCTGTGTCCAGCAGGAGAGG + Intergenic
910971286 1:92858439-92858461 TGTGCTGTGTGCTAGAGAGGAGG - Intronic
911429816 1:97771068-97771090 AGTACTTTGTGGAGCTGAGGCGG + Intronic
911507552 1:98772265-98772287 AGTGCTTTGTGAAGCCGAGGTGG + Intergenic
911716567 1:101140070-101140092 TGTGCTGTGTGTTGGAGAAGGGG - Intergenic
912424930 1:109578956-109578978 GGTGGTGTGTGGAGGAGTGGTGG + Intronic
912699217 1:111864042-111864064 TTTGATATGGGGAGCAGAGGAGG + Intronic
912794984 1:112687898-112687920 TGTGCAGGGAGGGGCAGAGGGGG - Intronic
913106756 1:115621882-115621904 TGGGCTGTGTGTAGCGAAGGGGG - Intergenic
915082886 1:153364132-153364154 TCTGCTGAGTAGAGCAGAGTGGG + Intergenic
916188088 1:162152387-162152409 TGTGCAGTGTCAAGGAGAGGGGG + Intronic
916921440 1:169471914-169471936 TGTGCTGTTTAGCCCAGAGGGGG + Intronic
918840741 1:189534588-189534610 TTTGCAGTGTGGAGGAAAGGTGG + Intergenic
918994519 1:191739533-191739555 AGTTCTGTGTGGAACAGAAGAGG - Intergenic
920208727 1:204312975-204312997 TGTGCTTTGAGAAGCTGAGGTGG - Intronic
922315263 1:224435476-224435498 TGTGGTGTGTAGAGAAGGGGAGG + Intronic
922515721 1:226206890-226206912 TGTGCTGAGGGGAGGAGAGAAGG + Intergenic
922706697 1:227794141-227794163 TGTGCTGGCTGGGGCAGTGGGGG + Intergenic
923170140 1:231408293-231408315 TGTGCTGGGAGGAGGAGAAGGGG + Intronic
923304419 1:232675107-232675129 GGTGCTCTTGGGAGCAGAGGCGG - Intergenic
924003648 1:239582543-239582565 TGTCCTGTATGGAGCAGAGGAGG - Intronic
924858541 1:247898174-247898196 TGTGAGGTGTGGAGGTGAGGAGG - Intergenic
1064032400 10:11891248-11891270 TGTGCTGTGGGGAGGGTAGGTGG - Intergenic
1066531997 10:36350902-36350924 AGTGCTTTGGGAAGCAGAGGTGG + Intergenic
1067572978 10:47384833-47384855 TGAGGTCTGGGGAGCAGAGGCGG - Intergenic
1067777473 10:49174022-49174044 TCTGCTGTGTGAAGCATAGCTGG - Intronic
1067831546 10:49613781-49613803 TATGGGGTGGGGAGCAGAGGTGG - Intronic
1068653918 10:59554909-59554931 AGTGCTGTGAGAATCAGAGGAGG - Intergenic
1068802021 10:61152205-61152227 TGTGTTTTGGGGAGCAGAGTTGG + Intergenic
1068915339 10:62425678-62425700 TGTGCAGTGTGAAGCAGGGAAGG - Intronic
1070379306 10:75866252-75866274 TGTGCTGTGTGGAGCAGAGGTGG - Intronic
1070961207 10:80501494-80501516 AGTGCAGTGTGGAGGAGAGAGGG + Intronic
1071257255 10:83881914-83881936 TCTGCTGAGTGGAACAGAGGGGG + Intergenic
1071500128 10:86197489-86197511 TCTCATGTGTGGAGCAAAGGAGG + Intronic
1071582354 10:86784129-86784151 TGTACTGTGTTGAGTAGAAGTGG + Intronic
1071679885 10:87694465-87694487 TGTGCTGCTTGGAGAACAGGTGG + Intronic
1072063351 10:91839262-91839284 TGTGCTCTTTGGTTCAGAGGAGG - Intronic
1072723705 10:97797997-97798019 TGTTCTCTGTGGACCAGATGAGG + Intergenic
1073114594 10:101084350-101084372 AGTGCTTTGTGAGGCAGAGGTGG + Intergenic
1073325709 10:102643233-102643255 CGGGGTGGGTGGAGCAGAGGTGG + Intergenic
1073839551 10:107482626-107482648 TGTGTTCAGTGGAGGAGAGGTGG + Intergenic
1074051979 10:109888406-109888428 TGTGGGGTGTGGAGCACTGGGGG - Intronic
1074490847 10:113938339-113938361 AGTGCTGTGGGGGACAGAGGAGG - Intergenic
1074494547 10:113968399-113968421 TGTGCTGCGTGCAGCTGAGCTGG - Intergenic
1074768993 10:116721358-116721380 TGTGCTCTGTGGAGGAGACCTGG - Intronic
1074965543 10:118487780-118487802 AGTGCTGGGTGGAGAAGAGCAGG - Intergenic
1075063420 10:119272767-119272789 TCTGGAGTGGGGAGCAGAGGAGG + Intronic
1075194086 10:120339793-120339815 TGTTCTGCCTGGAGTAGAGGTGG - Intergenic
1075274540 10:121081289-121081311 TTTGCTGTGAGGAACAGAGGTGG + Intergenic
1075277693 10:121109533-121109555 TCTGCTGTTGGGAGCACAGGGGG - Intergenic
1075747304 10:124736730-124736752 TGTGCCTTGTGCAGGAGAGGCGG - Intronic
1075774830 10:124975997-124976019 TGTCTTGTGGGGAGCGGAGGGGG + Intronic
1075828730 10:125384737-125384759 TGTGCTGGTTGGAGGAGTGGTGG + Intergenic
1075913724 10:126148301-126148323 TGTGCTGACTTGAGCAGAAGAGG + Intronic
1076326675 10:129629018-129629040 TGTGCTGTGTGCTGCAGGAGAGG - Intronic
1076461150 10:130648546-130648568 GGTGCTGTGTGGATCAGGGCAGG + Intergenic
1076535886 10:131177514-131177536 TGTGCTGGGAGGAGCAGTGCAGG - Intronic
1077020357 11:414408-414430 TGTGATGTGTGCAGGGGAGGAGG - Intronic
1077175254 11:1186751-1186773 TGTGCTGGTTGTAGCAGTGGAGG - Intronic
1077192704 11:1262120-1262142 TGGGCTGGGTTGAGCAGAGGGGG - Exonic
1077301354 11:1848607-1848629 TTTGCTGTGGGGAGCAAAGCTGG - Intergenic
1078881021 11:15448793-15448815 TGTACTGGCTGGATCAGAGGAGG + Intergenic
1080036869 11:27719898-27719920 TGTGCGGTGGGGAGAGGAGGTGG - Intronic
1081767858 11:45624368-45624390 AGTGCTGCGAGGAGCAGGGGTGG - Intergenic
1081988824 11:47326674-47326696 TGTGCTGTGTGGGGCAGGGGTGG + Intronic
1082105560 11:48217516-48217538 TGTGATGTGAGAAGCACAGGTGG - Exonic
1082990763 11:59205543-59205565 AGAGCTGTGAGGAGGAGAGGAGG - Exonic
1083762199 11:64824659-64824681 TGTGAGGTGAGGAGTAGAGGTGG + Intronic
1083762805 11:64827816-64827838 TGTTCCCTGTGGAACAGAGGGGG - Intronic
1083808340 11:65088149-65088171 TGGGTTCTGTGGAGGAGAGGCGG + Exonic
1083853105 11:65379190-65379212 AGGGCTGTGGGGAACAGAGGGGG - Intronic
1084214105 11:67638477-67638499 TGGGATGCCTGGAGCAGAGGGGG + Intronic
1084278302 11:68068208-68068230 TACGCTGTGTGGTGCAGAAGGGG + Intronic
1084421784 11:69064008-69064030 TGTGCTGTGACTAACAGAGGGGG + Intronic
1084708830 11:70831419-70831441 TGGGCTGAGTGGAGCTGAGTTGG - Intronic
1085445334 11:76597505-76597527 TGTGTTGTGGGGAGCACATGGGG - Intergenic
1087069527 11:94063790-94063812 CATTCTGTGTGGAGCAAAGGAGG - Intronic
1087170545 11:95045499-95045521 TGTCCTGGGTTGAGCAGAGATGG - Intergenic
1088588105 11:111377773-111377795 AGTGCTGTGTGGATGAGAGCAGG - Intronic
1088946037 11:114513253-114513275 TGTGCTGTGTGCAGCACTGGTGG + Intergenic
1088947656 11:114530702-114530724 TGTGCTGTGTGTGGCACTGGTGG + Exonic
1088963821 11:114698229-114698251 TGTGCTGTGTGTGGCACTGGTGG - Exonic
1089183030 11:116595945-116595967 TGAGCTGGGAGGAGGAGAGGAGG + Intergenic
1089194825 11:116688130-116688152 TATGGTGGGTGGAGAAGAGGAGG - Intergenic
1089496913 11:118912616-118912638 AGTTGTGTGTGGAGCAGAGCCGG - Intronic
1090106764 11:123861885-123861907 GGTGATGTGTGAAGCACAGGTGG + Intergenic
1090242150 11:125191674-125191696 GGTGCGGTGTGGAGTGGAGGTGG + Intronic
1090475458 11:127015995-127016017 TGTGCTGTGTGGAGAAGTTGTGG + Intergenic
1090817212 11:130309102-130309124 TCTGCTGTGTGCTGCAGAGAGGG - Intronic
1090944880 11:131420906-131420928 TGGTCTGCGTGAAGCAGAGGAGG - Intronic
1091034270 11:132219045-132219067 TGTGGTGTGTGGAGAAAATGGGG - Intronic
1091352209 11:134906586-134906608 TGTACTGTGTGGAGGACATGAGG + Intergenic
1091750341 12:3018300-3018322 TGTGCTGTGTGGACCACACCTGG + Intronic
1092751630 12:11724608-11724630 TGTGCTCTGTGTATCAGAAGAGG + Intronic
1092996933 12:13959478-13959500 TGTGGAGGGTGGAGGAGAGGAGG + Intronic
1093442155 12:19211746-19211768 TGTGATGAGCTGAGCAGAGGAGG + Intronic
1093642500 12:21543383-21543405 AGTGGTGGGTGGTGCAGAGGAGG + Intronic
1093915971 12:24803031-24803053 TGTGCTGAGTGGTCCATAGGTGG - Intergenic
1094042822 12:26135247-26135269 TGGGCTGAGTGGATCACAGGAGG + Intronic
1094080435 12:26528812-26528834 TGTGCTGTGTTGTGCACTGGAGG + Intronic
1095243687 12:39892119-39892141 CATGCTATGTGGAGCAGAAGTGG - Intronic
1096576215 12:52554390-52554412 TTTGCTGGGTGGGGCACAGGAGG + Intergenic
1096693502 12:53335086-53335108 GCTGGTGTGTGGAGGAGAGGAGG - Intronic
1097181282 12:57173443-57173465 TGTGCTGTGTGGAGTGGTGCTGG + Intronic
1097249634 12:57625466-57625488 TGAGATGTGTGGAGAAGAGCGGG + Intronic
1098566267 12:71940237-71940259 TGTGTTGTGTGGTGAGGAGGAGG + Intronic
1101541158 12:105666708-105666730 TGTGCTGTGTGTGGTAGAGTAGG - Intergenic
1101906526 12:108830813-108830835 TGTGCTGTGTGAAACAGACATGG + Intronic
1102050356 12:109857479-109857501 TGGGCTCTGTGCTGCAGAGGAGG - Intronic
1102143639 12:110637602-110637624 TGTGCTGGTTGGAGCAGGGATGG + Intronic
1103404282 12:120664259-120664281 TGTGCTGGGGGAAGCACAGGGGG + Intronic
1104125778 12:125844363-125844385 TATGCTGTGTGAGTCAGAGGAGG - Intergenic
1104421293 12:128637762-128637784 TGGGCTGTTTGTAGCAGAGCAGG - Intronic
1105356509 13:19664297-19664319 TGTCTTGTGTGGAGCAGAGGTGG + Intronic
1105725834 13:23160816-23160838 AGTGCTGTCTGGGGCAGAGAAGG - Intergenic
1106251768 13:27987331-27987353 TGTGGGGTGAGGAGAAGAGGGGG - Intronic
1107223625 13:38018933-38018955 AGTGCTGTGTTGAGTAGAAGTGG + Intergenic
1107890524 13:44910425-44910447 GCTGCTGTGTGCAGCAAAGGGGG - Intergenic
1108194572 13:47979743-47979765 AGTGCTGTGTTGAACAGAAGCGG - Intronic
1108544454 13:51478510-51478532 TGTGGTCTGTGGAACAGAGAGGG + Intergenic
1108622351 13:52196202-52196224 TGTGCTATGTGGAGATTAGGAGG + Intergenic
1108680498 13:52776177-52776199 GGGGCTTTGTGGAGCTGAGGTGG + Intergenic
1111678641 13:91417053-91417075 TGGGGTGGATGGAGCAGAGGGGG + Intronic
1113351011 13:109529409-109529431 AGTGCTTTGGGGAGCTGAGGTGG - Intergenic
1113602611 13:111581053-111581075 TGTTCTGTGTGGAGCTGTGCTGG - Intergenic
1113990552 14:16024341-16024363 TGTACTGTGTGGGGGAGTGGGGG + Intergenic
1114202123 14:20531355-20531377 TGGGGTGTGTGTAGCAGAAGGGG - Intergenic
1116907145 14:50415167-50415189 AGTGCTTTGTGGGGCTGAGGCGG - Intronic
1117734572 14:58755740-58755762 TGTGCTGTGCAGAGCAGCTGGGG + Intergenic
1118136820 14:63037754-63037776 TGTGCAGTATGCAGCAGAAGAGG - Intronic
1118323422 14:64766505-64766527 TGCGCTGTGGGGAGGAGTGGAGG + Intronic
1118586569 14:67359301-67359323 TGAGCTCTGTAGGGCAGAGGTGG + Intronic
1118774343 14:68964335-68964357 CGTGCTGTGTTGAGCAGTGGAGG - Intronic
1119520102 14:75278912-75278934 TGGGCGCTGTGGAGCAGAGCTGG - Exonic
1121485798 14:94313461-94313483 TGTGATGAGGGAAGCAGAGGTGG + Intronic
1121626196 14:95387142-95387164 TGTGCAGAGGGGAGCAGAGGGGG - Intergenic
1121649207 14:95544794-95544816 TGGGCTGGAGGGAGCAGAGGTGG + Intergenic
1122244668 14:100394011-100394033 AGGGCTGTGAGGATCAGAGGAGG + Intronic
1123109261 14:105857947-105857969 TGGGCTGGGTTGAGCAGAGCTGG - Intergenic
1124639880 15:31391113-31391135 GGGGCTGTGTGGGGCTGAGGGGG + Intronic
1126314569 15:47356493-47356515 TGTGCTGTGGGAAGATGAGGAGG + Intronic
1126659991 15:51023611-51023633 TGTGCTGGGAGTAGCAGTGGTGG + Intergenic
1127186210 15:56483485-56483507 TGTGTTCTGTGGCTCAGAGGTGG - Intergenic
1127455697 15:59154296-59154318 CCTGCTGTGTGAGGCAGAGGGGG + Intronic
1128183578 15:65625411-65625433 TGTTCAGTGTGGAGGAGCGGCGG + Exonic
1128246746 15:66138170-66138192 TGTGCCCTAAGGAGCAGAGGGGG - Intronic
1128705915 15:69837461-69837483 TGTGCTGTGGGGAGCTGGAGAGG + Intergenic
1128712546 15:69883061-69883083 TGTGATGTGAGTATCAGAGGTGG - Intergenic
1129158880 15:73735984-73736006 TGTGCTGAGTGGTGCTGTGGAGG - Exonic
1129201666 15:74005975-74005997 TCTGCTGTGGGGGTCAGAGGTGG + Intronic
1130172301 15:81527968-81527990 TCTGTTGTGGGGAGCAGGGGTGG + Intergenic
1130225845 15:82057986-82058008 TCTGCAGTGGGGAGAAGAGGTGG - Intergenic
1131119437 15:89813713-89813735 TGTGTTTTGTGGAGGGGAGGTGG - Intronic
1131290000 15:91099344-91099366 TGTGCTCCATGGAGAAGAGGGGG + Intergenic
1131619211 15:94049225-94049247 TGTGCTGGATGAAGTAGAGGGGG + Intergenic
1131747302 15:95462966-95462988 GGGGCTGGGTGGAGCAGGGGTGG - Intergenic
1132144582 15:99421385-99421407 AGGGCAGTGTGGAGCAGTGGAGG - Intergenic
1132643789 16:989689-989711 CAGGCTGTGGGGAGCAGAGGTGG - Intergenic
1132780738 16:1623650-1623672 TGTTGTGGGTGGTGCAGAGGTGG + Intronic
1132867287 16:2099767-2099789 CGTGCTGTGTGGAGGAGAGGAGG + Exonic
1132871105 16:2116134-2116156 TGGGGTCTGTGGAGCTGAGGCGG - Intronic
1133171192 16:3983437-3983459 TGACCTGTGTGGAGCAGGAGTGG + Exonic
1133371794 16:5250893-5250915 TGGGCTGTCTGGATCAGAGGGGG + Intergenic
1134105810 16:11485369-11485391 TATTGTGTGTGGGGCAGAGGAGG - Intronic
1134219394 16:12341779-12341801 TGTGCCCTGTTGTGCAGAGGGGG + Intronic
1134262793 16:12666189-12666211 ACGGCTGTTTGGAGCAGAGGGGG - Intronic
1134521429 16:14920760-14920782 TGGGGTCTGTGGAGCTGAGGCGG + Intronic
1134524487 16:14933348-14933370 CGTGCTGTGTGGAGGAGAGGAGG - Intronic
1134548413 16:15127593-15127615 CGTGCTGTGTGGAGGAGAGGAGG + Intronic
1134709100 16:16319411-16319433 TGGGGTCTGTGGAGCTGAGGCGG + Intergenic
1134712076 16:16331835-16331857 CGTGCTGTGTGGAGGAGAGGAGG - Intergenic
1134716309 16:16359440-16359462 TGGGGTCTGTGGAGCTGAGGCGG + Intergenic
1134719933 16:16375128-16375150 CGTGCTGTGTGGAGGAGAGGAGG - Intergenic
1134947493 16:18336757-18336779 CGTGCTGTGTGGAGGAGAGGAGG + Intergenic
1134950505 16:18349234-18349256 TGGGGTCTGTGGAGCTGAGGCGG - Intergenic
1134954753 16:18376859-18376881 CGTGCTGTGTGGAGGAGAGGAGG + Intergenic
1134958441 16:18392719-18392741 TGGGGTCTGTGGAGCTGAGGCGG - Intergenic
1135081400 16:19439216-19439238 TGTGGTCTGTGGATCAGAGCTGG + Intronic
1136532563 16:30879358-30879380 TCTGCTGGGTGGAGAAGAGATGG - Intronic
1137455594 16:48615493-48615515 AGTGCAGAGAGGAGCAGAGGTGG - Intronic
1137485777 16:48889518-48889540 TGTGAAGTGTGGAGCAGAAGAGG - Intergenic
1137861463 16:51850852-51850874 TGTACTGAGTGGTCCAGAGGAGG - Intergenic
1139596156 16:67959574-67959596 TGTCCTGCGTGGAGCAGTGCAGG + Intronic
1140127273 16:72128566-72128588 ATTTCTGTGTGGAGGAGAGGTGG + Intronic
1141369461 16:83473730-83473752 TGAGCTGTGTGGAGCTGAGTAGG + Intronic
1141424103 16:83934439-83934461 TGAGGTGTGTGGGGCAGAGATGG - Intronic
1141575145 16:84958880-84958902 TGGTCTGTGTGGAGCAGAGGAGG - Intergenic
1141728972 16:85809352-85809374 TGTGCTGAGAGTAGCAGAGATGG + Intergenic
1143149314 17:4797698-4797720 GCTGCTGTGTGGACCAGTGGAGG - Exonic
1143457994 17:7080089-7080111 TGTGCTGCAAGGACCAGAGGTGG + Exonic
1146665844 17:34702805-34702827 TGTGCTGAATGGATCAGGGGAGG + Intergenic
1147170778 17:38617551-38617573 TTTGCTGAGTGGAAAAGAGGAGG + Intergenic
1147499153 17:40945648-40945670 TACCCTGTGTGGAGCAGAGAAGG + Intergenic
1147546146 17:41403111-41403133 CCTGCTGTGAGGTGCAGAGGGGG + Intergenic
1147552617 17:41455100-41455122 TGTGCTGTGTGAAGCAGGGATGG - Intergenic
1148355732 17:46974423-46974445 TGTGTTGTGGGGAGCAAAGGAGG + Intronic
1148689182 17:49516954-49516976 GGTGCTGGGTGGAGCAGGGTGGG + Intergenic
1149443066 17:56691294-56691316 GATGGTGTGGGGAGCAGAGGCGG + Intergenic
1150884874 17:69073300-69073322 AGTGCTGTGTGGTGCTGAGAAGG - Intergenic
1150986887 17:70208325-70208347 TGTGCTGGTTGGAGCAGGGCAGG - Intergenic
1151903887 17:77035287-77035309 TGTGCTGTGCAGAGATGAGGCGG + Intergenic
1151987560 17:77553871-77553893 TGTGCAGTGTGCAGGGGAGGTGG + Intergenic
1152693218 17:81730970-81730992 TGTGCCCAGTGAAGCAGAGGTGG + Intergenic
1152709920 17:81866295-81866317 TGTGCTGTGGGGGAGAGAGGCGG - Intergenic
1153577689 18:6539252-6539274 TGAGCTGTCTGGAGCAAAGTGGG + Intronic
1153732719 18:8030633-8030655 TGTTCTGTGTAGAGCACAGATGG + Intronic
1154190073 18:12223318-12223340 GGTGCTGGGTGGGGCAGAGTGGG - Intergenic
1154336568 18:13470768-13470790 AGTGCTGTGTGTGGCTGAGGAGG - Intronic
1155154854 18:23149673-23149695 TGTGCTCTCTGGACCAGCGGCGG + Intronic
1155167525 18:23243423-23243445 TGTGCTGTGTGGGGGAGGGAGGG + Intronic
1157188277 18:45559116-45559138 TGTGCTAGGTGGATTAGAGGGGG + Intronic
1157308058 18:46531233-46531255 TGAGCTGAGTGGGGCAGAGTGGG - Intronic
1157918771 18:51695179-51695201 TGTGCAGGGTGGAGGGGAGGAGG + Intergenic
1158157024 18:54437450-54437472 TGTTTTGTTTGGAGCAGAGCAGG - Intergenic
1158406363 18:57163239-57163261 GGTGCTTCATGGAGCAGAGGTGG + Intergenic
1159640986 18:70862615-70862637 TGTGCTTAGTGGAGAAGAGCAGG + Intergenic
1160330953 18:77991379-77991401 TCTGCTGGGTGGAGGAGAGCGGG - Intergenic
1160442300 18:78902088-78902110 TGTGGTGTGTGGAGGTGACGAGG - Intergenic
1160809166 19:1005610-1005632 TGGGCTGTGTGGGGCAGGGGTGG + Intronic
1161245384 19:3249047-3249069 TGGGCTGTGTGGTGGGGAGGGGG - Intronic
1161359906 19:3842259-3842281 TGTGCTTTGGGAAGCCGAGGCGG - Intronic
1161517040 19:4702342-4702364 TGTGCAGTGGGAAGCAGAGCAGG + Intronic
1161983706 19:7643229-7643251 TGTGTAGTGTGGAGCAGGTGGGG + Exonic
1162352308 19:10158211-10158233 TGTGCTGTGGTGGGCAGAGCTGG - Intronic
1163160531 19:15461473-15461495 GGTGCTGCTTGGAGGAGAGGAGG - Exonic
1163423787 19:17229710-17229732 TGTGATGGGTGGGGCACAGGTGG + Intergenic
1163580571 19:18136284-18136306 CCTGCTCTGTGGAGCAGAAGTGG + Intronic
1164670018 19:30067137-30067159 GGAGCTGTGTGAAGCAAAGGGGG + Intergenic
1164862437 19:31572798-31572820 TGTCTTCTGTGGAGGAGAGGTGG - Intergenic
1165078128 19:33291981-33292003 TGTGCTGTGTGTGTCAGGGGTGG - Intergenic
1166864201 19:45826232-45826254 TGTGCTGTTTGGAGCTGACAAGG - Exonic
1167047158 19:47056650-47056672 AGTGCTTTGTGGGGCTGAGGTGG + Intergenic
1168645994 19:58059598-58059620 TGCCCGGTGTGGGGCAGAGGTGG - Intronic
925130068 2:1488468-1488490 TGGGGTGTGGGGAGCACAGGGGG - Intronic
925977292 2:9150197-9150219 TGCGCTCTGTGGGGCAGAGCAGG + Intergenic
926915192 2:17884524-17884546 TGTGTTGTGTGTTGCAGAAGTGG + Intronic
927157026 2:20226301-20226323 AGTGCTGTGAGGAGGAGTGGGGG - Intergenic
927180278 2:20441109-20441131 AGTGCTGTGGGAGGCAGAGGTGG + Intergenic
927290744 2:21402585-21402607 GGTGCTGTCTGGAGCACAGCGGG + Intergenic
928413506 2:31072151-31072173 TCTGCTGTGGGGTGCAGAGGTGG + Intronic
928414801 2:31083266-31083288 TTAGCTGTGGGGATCAGAGGGGG + Intronic
928665758 2:33549066-33549088 TGTTCTGTGTGGAGTAGATCTGG + Intronic
929308381 2:40392782-40392804 TATGATTTGTGGAGCAAAGGAGG + Intronic
929629294 2:43442894-43442916 GGTGCGGTGGGCAGCAGAGGCGG - Intronic
932423969 2:71617624-71617646 GGTGATGTGTGTGGCAGAGGTGG + Intronic
932424134 2:71618640-71618662 GGTGGTGTGTGTGGCAGAGGAGG + Intronic
934475142 2:94588579-94588601 TGGGCTGGGTGGAGGACAGGGGG - Intronic
934714721 2:96536931-96536953 TGCGCTGTGTGGGGCGGAGAGGG + Intronic
935572208 2:104673646-104673668 TGTGCTGTTTAGAGAAGAGGGGG - Intergenic
935673551 2:105575518-105575540 TGTTCTGAGCGGAGCTGAGGTGG + Intergenic
935673787 2:105576932-105576954 AGAGCTGTGTGGGGCAGAGGTGG + Intergenic
936513955 2:113170001-113170023 TCTGCTGTATGGAGAAGAGATGG - Intronic
937081425 2:119142915-119142937 TTTGCTGAGTGGGGCTGAGGTGG - Intergenic
937333360 2:121045643-121045665 TGTCCTGTCGGGAGCAGAGGGGG - Intergenic
937361682 2:121234067-121234089 TGAGTTGTGGGGAGCAGAGCTGG - Intronic
938226861 2:129624162-129624184 TGTGGGGTGGGGAGCTGAGGTGG + Intergenic
938421571 2:131151400-131151422 GGTGCTGTAGGAAGCAGAGGGGG + Intronic
938851234 2:135262532-135262554 TGTGCTTTGGGAGGCAGAGGTGG + Intronic
940849360 2:158673432-158673454 TGAGCTCTGTGGAGCAGCTGTGG - Intronic
941079801 2:161047208-161047230 AGTGCTTTGGGGAGCTGAGGTGG + Intergenic
942465474 2:176203317-176203339 AGTGCAGTGTGGAGCACAGAAGG - Intergenic
945007791 2:205427971-205427993 TTTGCTGTGGGGAACAGAGTTGG - Intronic
945033369 2:205685006-205685028 TGTGCTGTGCGGAGCGGGAGGGG + Intronic
946392728 2:219426249-219426271 TGTGCTGGATGGAGCCCAGGCGG + Exonic
946516492 2:220417180-220417202 CGTGGTTTGTGGAGCAGTGGGGG + Intergenic
946887315 2:224235022-224235044 TGTGCTGTGTGCAAATGAGGAGG + Intergenic
946994048 2:225370800-225370822 TGTGATGTGGAGTGCAGAGGAGG - Intergenic
948049603 2:234969628-234969650 TGTGCTGTGTGGAAAAGCGGAGG - Intronic
948336769 2:237214431-237214453 TCTGCTGTGTGGTGCAGAAGAGG - Intergenic
1168822698 20:786342-786364 GGTACTCTGGGGAGCAGAGGTGG + Intergenic
1168827378 20:822971-822993 TGTGCTGGGTGGAGGATGGGTGG + Intergenic
1171052655 20:21874417-21874439 TCTGATGTGGGCAGCAGAGGGGG - Intergenic
1171087375 20:22250382-22250404 TGTGCTGTGAGGAGGAAATGAGG - Intergenic
1171380583 20:24731338-24731360 TGTGCTGTGAGGAGCCCATGAGG + Intergenic
1172656188 20:36540400-36540422 TTTGCTGTGTGGAGCAGTTTGGG - Intergenic
1172873151 20:38148177-38148199 TCTGCTGTGTGGGACAGAGTGGG - Intronic
1173021056 20:39268629-39268651 TGTGGAGTATGGAGCAGAGCCGG + Intergenic
1173400307 20:42720424-42720446 TGAGATGTGTGTTGCAGAGGTGG + Intronic
1174597553 20:51696188-51696210 TGTGCTGTGCGGTGGGGAGGGGG + Intronic
1175038297 20:56021125-56021147 TGTGCTGAGTGCAGTAGAAGAGG - Intergenic
1175249748 20:57602065-57602087 TTTGATATGGGGAGCAGAGGAGG + Intergenic
1175934851 20:62509866-62509888 GGTGCGGGGTGGAGCAGTGGAGG - Intergenic
1177301601 21:19252553-19252575 TGTGCTAAATGGAGCAGAGTAGG - Intergenic
1178482722 21:32993661-32993683 TGCCCTCTGTGGAGCAGAGATGG - Intergenic
1179114771 21:38480146-38480168 TGTCCTGGGTGGAGCAGGGCAGG + Intronic
1179455043 21:41493405-41493427 TGTCCTGAGTGGGGGAGAGGTGG + Intronic
1179719519 21:43307300-43307322 TCTCCTGTGTGGAGAGGAGGCGG - Intergenic
1179826368 21:43968454-43968476 GGTACTGGGTGGAGCAGTGGGGG + Intronic
1180316718 22:11283185-11283207 TGTACTGTGTGGGGGAGTGGGGG - Intergenic
1180653637 22:17400360-17400382 TGAGGTGTGTGGAGTAGATGAGG + Intronic
1180947491 22:19704689-19704711 TGTTTTCTGTGGAGCAGTGGGGG + Intergenic
1181758336 22:25040849-25040871 TGGGCGGGGTGGAGCAGAGAAGG + Exonic
1181777547 22:25170498-25170520 TGTACTGTGAGGAGGAGAGAGGG + Intronic
1183173097 22:36202355-36202377 AGTGCTGTGGGAGGCAGAGGCGG - Intronic
1183177854 22:36237657-36237679 AGTGCTGTGGGAGGCAGAGGCGG - Intronic
1183180117 22:36254314-36254336 AGTGCTGTGGGAGGCAGAGGCGG + Intronic
1183218033 22:36493800-36493822 TGTTCTGTGGGGAGGAGAGAGGG + Exonic
1183230748 22:36580433-36580455 TGTGTTGTGGGGAGCTGAGTGGG + Intronic
1183422070 22:37717872-37717894 TGGGCGCTGTGGAGCAGGGGCGG + Intronic
1184720534 22:46309880-46309902 CCTGCTGTGTGGAGCACACGTGG + Intronic
1185068905 22:48645624-48645646 TGTAATGTGGGGAGCAGAGGTGG + Intronic
1185372789 22:50468715-50468737 TGTGCTGTGTGAAGCTGGGCTGG - Intronic
949383399 3:3470627-3470649 GATGCTGTGTGGAGAATAGGTGG - Intergenic
949392367 3:3577351-3577373 GGTACTGTCTGGAGCTGAGGAGG - Intergenic
949909646 3:8891301-8891323 TGTGTGTTGTGGAGCACAGGGGG - Intronic
950540408 3:13609117-13609139 TGGGCTGCCTGGGGCAGAGGTGG - Intronic
950552435 3:13674922-13674944 TGTGGGTTGTGGAGCGGAGGAGG + Intergenic
950563393 3:13749074-13749096 TGGAGGGTGTGGAGCAGAGGAGG - Intergenic
950893025 3:16421922-16421944 TGTGCTGTATGGAGCAGGAGGGG - Intronic
952206605 3:31186647-31186669 TGTGCTGTCTAGATCAGTGGTGG - Intergenic
952879201 3:37972699-37972721 TGTGCTGTGTGGGGCAGGCAGGG + Intronic
953999908 3:47548138-47548160 TGCACTGTGGGAAGCAGAGGAGG + Intergenic
954045259 3:47924508-47924530 TGTGGTGTGTGAAAAAGAGGAGG - Intronic
954353602 3:50066332-50066354 TGTGCTGTGCGGGGCTGTGGGGG - Exonic
954489230 3:50885878-50885900 TTTGGTGTGGGGGGCAGAGGGGG + Intronic
955322028 3:57981458-57981480 TGTCCTATGTGGTGCAGAGGAGG - Intergenic
957397967 3:79668596-79668618 TTTGGTGTGTGGAACAGAAGTGG - Intronic
957459508 3:80497953-80497975 TGTGCTCTGTGGAGCCCATGGGG - Intergenic
959107319 3:102079417-102079439 TCTGCTTTGGGGAGAAGAGGAGG - Intergenic
960993074 3:123324326-123324348 TGGGCTCTGTGGAGCAGACTGGG - Intronic
961008351 3:123419930-123419952 TGTGCTGGGTGGAGGGGTGGGGG - Intronic
961564576 3:127754435-127754457 TGAGGTGCGTGGAGCAGAAGGGG - Intronic
961739173 3:129021995-129022017 TCTGCTGTGAGGGGCAGAGGTGG + Intronic
963034127 3:141010415-141010437 TGTCCTGTGTGAAACAGTGGAGG + Intergenic
963444786 3:145390536-145390558 TGTACTGTGTTGAACAGAAGTGG - Intergenic
964194570 3:154047704-154047726 TGCCCTGGGAGGAGCAGAGGAGG - Intergenic
965507643 3:169534096-169534118 TCTGCTGGGTGCAGGAGAGGAGG - Intronic
965679480 3:171235458-171235480 TGTGCTGTGTGGGGAGGAGTGGG - Intronic
966930000 3:184670342-184670364 TGTGCCGTGGGCAGCAGAGGAGG - Intronic
967608886 3:191481402-191481424 TGTGCTGCCTGGAGTTGAGGAGG - Intergenic
967673013 3:192261322-192261344 AGTGATGTGTAGAGCAGAGGAGG - Intronic
967864261 3:194177499-194177521 TGTTCTGTGTGGAGCAGGTATGG + Intergenic
968895983 4:3403687-3403709 TGTGCTGCTTAAAGCAGAGGGGG + Intronic
969354936 4:6619763-6619785 TGTGCTGTGAGAAGCAGATGAGG + Intronic
969435064 4:7184455-7184477 TGTGTTGTGTGCTGCAGAGGGGG - Intergenic
969587445 4:8102602-8102624 TGAGCTGTGGGTGGCAGAGGTGG + Intronic
969719966 4:8888209-8888231 TGAGCTGTGGGGTGCGGAGGTGG - Intergenic
970066980 4:12106597-12106619 TGAGAATTGTGGAGCAGAGGAGG - Intergenic
970318409 4:14851781-14851803 TGTGCTGAGTTGTGCAGAGTTGG + Intergenic
970558079 4:17256084-17256106 TGTGCTGGGTGTAGGAGATGGGG + Intergenic
970842953 4:20497645-20497667 AGTGCTGTGTGGAGAAGATTCGG - Intronic
971490551 4:27207892-27207914 TGTTCTGTGTGGTGAATAGGTGG + Intergenic
972312082 4:37891165-37891187 TCAGCTGGGTGGAGAAGAGGCGG + Exonic
973293992 4:48495571-48495593 TGTGCTCGGTAGAGAAGAGGTGG + Intergenic
973765767 4:54161042-54161064 GGTGCAGTGGGGAGCAGGGGTGG - Intronic
974267057 4:59598822-59598844 TGTGCTGCCTGGAGCTGGGGAGG - Intergenic
975997037 4:80327781-80327803 TGTGCAGTGTGAGGCAAAGGGGG + Intronic
976137308 4:81952535-81952557 TGGGCTGAATGTAGCAGAGGTGG - Intronic
980896703 4:138867162-138867184 TGTGTTGTGTGGAGGATAGATGG - Intergenic
981362518 4:143863853-143863875 TGGGGTGTGTGGAACAGAGGTGG + Intergenic
981373247 4:143984646-143984668 TGGGGTGTGTGGAACAGAGGTGG + Intergenic
981382345 4:144087894-144087916 TGGGGTGTATGGAACAGAGGTGG + Intergenic
982068192 4:151672967-151672989 TGTGCTGTGTGGAGCTGGGGTGG + Intronic
982321967 4:154086324-154086346 TGTGAGTTGTGGAGCTGAGGTGG + Intergenic
984726277 4:183024597-183024619 TGCGCTGTGTGGAGAAAAGGAGG + Intergenic
986741284 5:10707600-10707622 TGAGCAGTGTGGTGCACAGGCGG + Intronic
987709029 5:21485924-21485946 TTTGCTGTGCGGGGCAGCGGGGG - Intergenic
988500763 5:31781893-31781915 TGGGCTGTGAGGAGCAGATTTGG + Intronic
989365039 5:40646369-40646391 ATAGCTTTGTGGAGCAGAGGGGG - Intergenic
990951060 5:61298931-61298953 TGTGCTTTGTGGAGCAATAGTGG + Intergenic
991593398 5:68277934-68277956 TGTACTCAGTGGAGCAAAGGTGG - Intronic
991941811 5:71860624-71860646 TCTGCTTTGGGAAGCAGAGGTGG - Intergenic
992649162 5:78840683-78840705 TGTGATTTATGGAGTAGAGGGGG - Intronic
994208462 5:97061876-97061898 TGTGTGGAGTGGGGCAGAGGAGG - Intergenic
995725296 5:115175763-115175785 TGTGCTGTGGGGAGTAGGGAAGG - Intronic
996034735 5:118746032-118746054 TGTACTGGGAGGAACAGAGGAGG + Intergenic
996768607 5:127061208-127061230 AATGCTCTGTGAAGCAGAGGAGG - Intronic
996777562 5:127149115-127149137 AGGGCTGTGAGGAGCAGAGCGGG - Intergenic
997255503 5:132425023-132425045 TGTTCTGTGAGAGGCAGAGGGGG + Intronic
997622746 5:135309469-135309491 TGTGCTCTTTGGATCAGAGGGGG + Intronic
998385852 5:141756747-141756769 TGGGGTGTGTGAAGGAGAGGTGG - Intergenic
998447623 5:142210912-142210934 TGCCCTGTGTGGAGCAGTGGTGG - Intergenic
998623669 5:143822086-143822108 TTGGCTGTGAGCAGCAGAGGAGG + Intergenic
999708745 5:154297481-154297503 TGTGCTGTGGGTATCAGAGGAGG + Intronic
1000122433 5:158209836-158209858 CCTGCTGTGGGGACCAGAGGAGG + Intergenic
1000563980 5:162825047-162825069 GGTGGTGTGTGGGGCAGGGGTGG + Intergenic
1000828063 5:166070706-166070728 TGTGCAGAGTGGAGGAGAGAGGG + Intergenic
1001439087 5:171724893-171724915 GGAGCTGTGTGGAGCAGGGAAGG + Intergenic
1002297573 5:178240035-178240057 TGTGCTGGCTGGAGCAGGGCAGG + Intronic
1002412079 5:179088894-179088916 AGTGCAGTGTTGAGGAGAGGAGG + Intergenic
1002846286 6:948080-948102 TGGGCTAAGTGGAGCACAGGTGG + Intergenic
1003046733 6:2740266-2740288 AGTACTGGCTGGAGCAGAGGTGG - Intronic
1004103287 6:12637955-12637977 TGTGCTGTTTGTAGGAGAGTAGG - Intergenic
1004742109 6:18472098-18472120 TGTTCTGAGAGGAGAAGAGGGGG + Intergenic
1005082065 6:21966138-21966160 TGTACTGTGTACTGCAGAGGTGG - Intergenic
1006645132 6:35510623-35510645 TGAGCTCTGTGAGGCAGAGGAGG - Intronic
1006840082 6:37022863-37022885 TGTGCTGTGAGGGCCAGATGAGG - Intronic
1007239525 6:40414998-40415020 TGTCCTGTGTGGACCAAAGTGGG - Intronic
1007737713 6:43992070-43992092 TGTGCTGTGTGTAGGAGATCTGG + Intergenic
1008490358 6:52079983-52080005 TGTGCTGTCTGAAGCACATGAGG - Exonic
1009027174 6:58013892-58013914 TGTGCAGTATGGAGCCTAGGAGG - Intergenic
1009202716 6:60765368-60765390 TGTGCAGTGTGGAGCCTAGGAGG - Intergenic
1010812594 6:80317069-80317091 TGAGCTGTCTGGATCAGATGTGG + Intronic
1011611574 6:89156614-89156636 TGTGTCGTGAGGATCAGAGGTGG + Intronic
1013044885 6:106475453-106475475 TTTGCTGTGTGAATCAGAGTTGG + Intergenic
1013055474 6:106578665-106578687 TTGGCTGTGTGGAGCAGCTGCGG + Intronic
1014022837 6:116610627-116610649 TGTGCTTTGTGGGGCTGAGGTGG - Intergenic
1015128581 6:129784132-129784154 TGTGCTGTGAGGAAGAGAGGTGG - Intergenic
1016466081 6:144327057-144327079 TCTGCTGTGTGAAGCCGAGGGGG + Intronic
1016712157 6:147186135-147186157 GGTGCAGTGGGGAGAAGAGGAGG + Intergenic
1016833449 6:148454711-148454733 TGGGCTGTGTGCATCACAGGAGG + Intronic
1017722410 6:157253146-157253168 TGTGCTGTGGGTGGCAGAGCAGG + Intergenic
1019481706 7:1269972-1269994 TGAGCACTGTGGAGCAGAGCCGG + Intergenic
1019955661 7:4412409-4412431 GATGCTGTTTGGAGCAGAGGTGG - Intergenic
1020448213 7:8292312-8292334 TGTTTCCTGTGGAGCAGAGGTGG - Intergenic
1020715766 7:11673632-11673654 TGTTCTGTGTGGGGCAGTGGAGG - Intronic
1020747440 7:12094855-12094877 TGTGCTGGCAGGAGCAGAGGAGG + Intergenic
1021198771 7:17702900-17702922 AGTACTGTGTTGAGCAGAAGTGG - Intergenic
1021811975 7:24411269-24411291 TTTGCTGTGTGTAACTGAGGAGG + Intergenic
1021848247 7:24783560-24783582 TGAGGTGTTTGGAGCAGAGAAGG + Intergenic
1022702911 7:32778177-32778199 AGTGTTGTGTGGTGCAGAGTGGG - Intergenic
1022907142 7:34868297-34868319 AGTGTTGTGTGGTGCAGAGTGGG - Intronic
1023818463 7:43967390-43967412 AGTGCTTTGGGAAGCAGAGGTGG - Intergenic
1023870079 7:44258607-44258629 TGTTCTGTGTGGAGGAGAGGGGG + Intronic
1024607151 7:51031412-51031434 TGTGCAGTGTTGAGGTGAGGTGG - Intronic
1026101837 7:67390269-67390291 TGTGCTGTGGGAAGGGGAGGGGG - Intergenic
1026788005 7:73313794-73313816 TGGGCTGTGGGGGGCTGAGGTGG + Intronic
1028611938 7:92721322-92721344 TGTGCGGTATGGGGCAGGGGTGG + Intronic
1029379050 7:100200722-100200744 TGTGCTGTGGGGATGGGAGGAGG - Exonic
1029737469 7:102472702-102472724 TGTGCTCTGTGGGGATGAGGAGG + Exonic
1030199805 7:106891150-106891172 TTTGCTGAGTGGAGTAGTGGAGG + Intronic
1030462165 7:109853227-109853249 GCTGCTGTTTGGAGAAGAGGTGG - Intergenic
1030657087 7:112180389-112180411 TGTGCTGTGTGGACCTGTCGGGG - Intronic
1031951863 7:127901072-127901094 TTTGCTCTGTGGAGCAGATAAGG + Intronic
1032239963 7:130153085-130153107 TGTGCTGTGCGGAGGAGCAGAGG + Intergenic
1032321649 7:130891313-130891335 AGAGCTGTGTGGTGCAGAGGAGG + Intergenic
1032448108 7:132002043-132002065 TGTGTGGTGTGGAGCAGGTGAGG + Intergenic
1034095382 7:148403215-148403237 TGTGCTTGGTGGAGGAGGGGAGG + Intronic
1035049072 7:155988079-155988101 TGGGCTGGGTGGATCTGAGGAGG + Intergenic
1035251701 7:157601903-157601925 TGTACTATGTGCAGCAGAGTTGG - Intronic
1035613233 8:983112-983134 TGTGCTGTGTGGACCAAGGCCGG - Intergenic
1036775852 8:11612810-11612832 AGTGCTCTGAGGTGCAGAGGAGG - Intergenic
1037505343 8:19524044-19524066 AGTGCTGTGGGAAGCTGAGGTGG + Intronic
1038191532 8:25325516-25325538 TGAGCTTTGTGGAGCAGATGAGG - Exonic
1041862377 8:62529381-62529403 GTTGTTGAGTGGAGCAGAGGAGG - Intronic
1042132936 8:65606926-65606948 TTTGGTGTGTGGGCCAGAGGTGG - Intronic
1043197961 8:77324194-77324216 TGTGCTGAGTAGAGCATAAGGGG - Intergenic
1044474193 8:92606849-92606871 TGTTCTGTGTGGTGAAGATGTGG - Intergenic
1044899055 8:96924955-96924977 AGTGATATGTGGAGCAGAAGGGG - Intronic
1044927069 8:97218492-97218514 TGTGCTGTGAGGGGCATGGGAGG - Intergenic
1045244536 8:100431403-100431425 TGTGCTGGGTGGGGAAGGGGAGG + Intergenic
1045951302 8:107854500-107854522 TGTGTTTTGGGGAGCAGGGGAGG + Intergenic
1046973200 8:120245372-120245394 AGTGCTGGGTGGCACAGAGGAGG + Intronic
1047291794 8:123538248-123538270 TGTGCTGTGTGGACAAGACTTGG + Intronic
1048662879 8:136626375-136626397 TCTGCTGTGTGGGACAGAGCTGG + Intergenic
1048987578 8:139743023-139743045 TGGGCTGAGAGGAGCAGGGGAGG + Intronic
1049206920 8:141367838-141367860 TGTGCTGTGTGGGGGGCAGGAGG + Intergenic
1049824691 8:144661195-144661217 CAGGCAGTGTGGAGCAGAGGAGG + Intergenic
1052842301 9:33302913-33302935 AGCGCTTTGTGAAGCAGAGGTGG - Intronic
1053508674 9:38668667-38668689 TCTGGGGGGTGGAGCAGAGGAGG - Intergenic
1053532892 9:38899336-38899358 GGTGCTGGGCGAAGCAGAGGAGG - Intergenic
1053682930 9:40497512-40497534 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1053932911 9:43125826-43125848 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054205118 9:62123765-62123787 GGTGCTGGGCGAAGCAGAGGAGG - Intergenic
1054280784 9:63127416-63127438 TGGGCTGGGTGGAGGACAGGGGG - Intergenic
1054296030 9:63333012-63333034 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054394046 9:64637507-64637529 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054428695 9:65142719-65142741 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054501684 9:65878823-65878845 TGGGCTGGGTGGAGGACAGGGGG - Intronic
1054633241 9:67464605-67464627 GGTGCTGGGCGAAGCAGAGGAGG + Intergenic
1056614409 9:88151355-88151377 TATGCTGGGTGGAGGTGAGGAGG + Intergenic
1056690477 9:88804106-88804128 TGTGCTGGCTGGATCAGGGGAGG + Intergenic
1056928416 9:90854248-90854270 TGTGCAGCATGGAGCAGGGGCGG + Intronic
1056990385 9:91405168-91405190 TGTGTTCTGTGGGGCAGAGATGG - Intergenic
1057151326 9:92798570-92798592 GGTGCTGGGCGAAGCAGAGGAGG + Intergenic
1057561135 9:96128796-96128818 TGTCCTGGGTGGAGCAGTGAGGG + Intergenic
1057584968 9:96320920-96320942 TGTGCTGTGTGCTGGGGAGGAGG - Exonic
1057913696 9:99039707-99039729 AGTGGTGTGTGGAGAAGATGGGG - Intronic
1059015797 9:110514262-110514284 TGTACTTTGGGAAGCAGAGGCGG + Intronic
1059289449 9:113209810-113209832 TGTGATGAGCTGAGCAGAGGAGG - Intronic
1060231719 9:121830408-121830430 TGTGCAGTGGGGAGCAGGGAGGG - Intronic
1060407747 9:123381276-123381298 TGGGCAGTGTGGAGGGGAGGAGG + Exonic
1060421635 9:123473311-123473333 TGTGCTGGGAGGGGCAGGGGAGG + Intronic
1060672105 9:125478876-125478898 TGTGCTGTGTAGATTAGATGAGG + Intronic
1060999885 9:127897130-127897152 TGGGGTGTGCGGAGCAGAGCTGG - Intronic
1061067116 9:128285461-128285483 TGTGCAGAGGGAAGCAGAGGTGG - Intronic
1062326908 9:136016894-136016916 ACTGCTGGGTGGAGGAGAGGTGG + Intronic
1187135819 X:16546221-16546243 TGTGCAGGGTGGGTCAGAGGTGG - Intergenic
1188468184 X:30506818-30506840 AGTGACATGTGGAGCAGAGGTGG - Intergenic
1188716283 X:33463609-33463631 TGTGCTGTCTGGGGCTGGGGTGG + Intergenic
1190631360 X:52389812-52389834 AGTGCTGGGAGGAGTAGAGGAGG - Intergenic
1192198469 X:69048151-69048173 TATGGAGTGTGGAGCAAAGGAGG + Intergenic
1192218425 X:69179948-69179970 TGTGCATGGTGGAGCAGGGGTGG - Intergenic
1194816315 X:98446294-98446316 TGTGCTGCTTGTAGCCGAGGTGG + Intergenic
1196014253 X:110920623-110920645 TGCGGGGTGTGGAACAGAGGCGG - Intergenic
1196765423 X:119237444-119237466 TGTGCTGTGTGTGGCAGATGGGG + Intronic
1196892226 X:120302471-120302493 TGTGCAGGGAGGAACAGAGGGGG - Intronic
1197779501 X:130145566-130145588 TATGCTGTATGGAGAAGAGAGGG + Exonic
1197782747 X:130173267-130173289 TGTGTCATGGGGAGCAGAGGGGG + Intronic
1198478275 X:137016897-137016919 AGTGCTTTGTGAAGCTGAGGTGG - Intergenic
1198529807 X:137540952-137540974 TGTGATTTGTGGTGCAGAGAGGG + Intergenic
1198531310 X:137551295-137551317 TGGGGTGTGTGGAGCAGAGAGGG - Intergenic