ID: 1070379678

View in Genome Browser
Species Human (GRCh38)
Location 10:75869359-75869381
Sequence TATCACATATGGCAGCAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070379678_1070379683 -3 Left 1070379678 10:75869359-75869381 CCATATTGCTGCCATATGTGATA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1070379683 10:75869379-75869401 ATATTCCGTCTTGAGGGTGAGGG No data
1070379678_1070379685 12 Left 1070379678 10:75869359-75869381 CCATATTGCTGCCATATGTGATA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1070379685 10:75869394-75869416 GGTGAGGGCACATTTCTATATGG No data
1070379678_1070379682 -4 Left 1070379678 10:75869359-75869381 CCATATTGCTGCCATATGTGATA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1070379682 10:75869378-75869400 GATATTCCGTCTTGAGGGTGAGG No data
1070379678_1070379681 -9 Left 1070379678 10:75869359-75869381 CCATATTGCTGCCATATGTGATA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1070379681 10:75869373-75869395 TATGTGATATTCCGTCTTGAGGG No data
1070379678_1070379680 -10 Left 1070379678 10:75869359-75869381 CCATATTGCTGCCATATGTGATA 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1070379680 10:75869372-75869394 ATATGTGATATTCCGTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070379678 Original CRISPR TATCACATATGGCAGCAATA TGG (reversed) Intronic
914732673 1:150385661-150385683 CATCACATATGACAACACTAAGG - Intronic
916363709 1:163999680-163999702 TATTAGAAATGGCAACAATATGG + Intergenic
917931994 1:179828965-179828987 TATCAGATATGTCAGCAGCAGGG - Intergenic
918816761 1:189195795-189195817 AATCACATATGGCAGGGAAATGG - Intergenic
920141721 1:203820348-203820370 TAACACTTATGGTAGCTATAGGG + Intronic
921912779 1:220569270-220569292 TGTAACATATGGCAGGAAAATGG - Intronic
922194507 1:223348187-223348209 TATGACATATTGAAGCATTATGG - Intronic
923644213 1:235799706-235799728 TACCAGATATGGCAACAACATGG + Intronic
923909492 1:238424923-238424945 TATTACAGTTAGCAGCAATATGG - Intergenic
1062816673 10:506037-506059 TGTCACATTTGGCAGCACAAGGG + Intronic
1062871847 10:911583-911605 TATCAAATATGGCAAAAAGAAGG - Intronic
1063025081 10:2170201-2170223 TATGACATATGGCTCTAATAGGG - Intergenic
1063406115 10:5797070-5797092 TAACAAATATGGCAGAAGTAAGG + Intronic
1063783425 10:9352671-9352693 TATAACATTTGCCAACAATAGGG - Intergenic
1068200810 10:53781904-53781926 TCTCACTTATGGCAGCAAGGTGG - Intergenic
1069086723 10:64148927-64148949 TTTCACATGTGGAGGCAATAGGG + Intergenic
1070228613 10:74539581-74539603 TATCACTTATAGCAGAAAAAGGG - Intronic
1070379678 10:75869359-75869381 TATCACATATGGCAGCAATATGG - Intronic
1072052549 10:91720628-91720650 TAACATATATGGCAGGAAAAGGG + Intergenic
1075864050 10:125702630-125702652 TGTCTCACATGGCAGCAGTACGG - Intergenic
1081245064 11:40755783-40755805 TACCGTATTTGGCAGCAATAAGG + Intronic
1081476290 11:43435385-43435407 TATCTAACATGGCAGCAATCTGG - Intronic
1085539879 11:77257165-77257187 TGTCACATGTGCTAGCAATATGG + Intronic
1089844523 11:121447962-121447984 TATCAGATGTGGCAGAAAAAGGG + Intergenic
1090801889 11:130178325-130178347 TATCACGAATGACAGCAAAATGG + Intronic
1093208961 12:16284697-16284719 TATAACATATGGCAAAAATCAGG - Intergenic
1093818328 12:23578223-23578245 TGTCATAATTGGCAGCAATATGG + Intronic
1095102346 12:38198034-38198056 TAACTCATATGGCAGGAATTTGG - Intergenic
1095651924 12:44621140-44621162 TAGCACATGTGGCAGCAAGGAGG - Intronic
1097927502 12:65145875-65145897 TATCACATAGGGAAGTAATAGGG + Intergenic
1099195391 12:79609351-79609373 CATCACATATGGAAGTGATAGGG + Intronic
1099641165 12:85286924-85286946 TATCATAGGTGGCAGCAAAATGG - Exonic
1099883103 12:88492738-88492760 TATCACATATGTCTACAACATGG - Intergenic
1106908576 13:34437726-34437748 TATGATATATGCCAGAAATATGG + Intergenic
1107834516 13:44402827-44402849 TTTCCCATAAGGAAGCAATACGG - Intergenic
1109464708 13:62715051-62715073 AATCATATATTGCAGCAAAAAGG + Intergenic
1110337118 13:74345618-74345640 TATTAAATAAGGCAACAATATGG - Intergenic
1110401874 13:75101315-75101337 TATAAGATGTGGCACCAATATGG + Intergenic
1111735427 13:92132867-92132889 TATCACAGAGGCCTGCAATATGG + Intronic
1115418167 14:33160937-33160959 TAGCACATATTGGAGAAATATGG + Intronic
1116717923 14:48451188-48451210 TCTCCTATATAGCAGCAATAAGG - Intergenic
1120849323 14:89155262-89155284 GATCAGATATGGCAGCAATAAGG + Intronic
1126809909 15:52391522-52391544 TCTCAAATATGTCAGTAATAAGG + Intronic
1130229800 15:82087894-82087916 TATCACATATTGCAGCCAGGAGG - Intergenic
1131409580 15:92195729-92195751 TATTACATATGGCTATAATAAGG + Intergenic
1134876536 16:17704813-17704835 TATCTTATATGGCAGCAAAAGGG + Intergenic
1135037350 16:19089361-19089383 CCTCACCTATGGCAGCAAAATGG + Intergenic
1135066319 16:19313253-19313275 GATCACCCATGACAGCAATAGGG + Intronic
1135412119 16:22243147-22243169 TTTCACATAGGGCAGTAAAATGG + Intronic
1136125060 16:28173242-28173264 TATCAGAAATGTCAGCAATTGGG + Intronic
1137365561 16:47856445-47856467 TATCAAATGTGGCAGCATTGAGG - Intergenic
1137720938 16:50626986-50627008 ATTCACATATGGCAGCATAAAGG - Intronic
1141081710 16:81058823-81058845 TATCACATAAGGCAGGAAGGAGG - Intronic
1144023804 17:11260299-11260321 TATCAGATATTGCAGCAAAAAGG + Intronic
1146006227 17:29162399-29162421 AATCACATATTTCAGGAATAAGG - Intronic
1146207972 17:30921317-30921339 TATCATTTATAGGAGCAATATGG + Intronic
1146885503 17:36467966-36467988 CATCACCGCTGGCAGCAATAGGG + Intergenic
1154314665 18:13295127-13295149 CAGCAAATATGGCAGCAGTAGGG + Intronic
1155808385 18:30201083-30201105 GATCACTTTGGGCAGCAATATGG - Intergenic
1156090639 18:33464605-33464627 TATCACATCTGGGAACAATGAGG + Intergenic
1157450295 18:47781326-47781348 TTTCACAGATGGCAGAACTAAGG + Intergenic
1159044568 18:63356788-63356810 TATCAGATATTACAGGAATACGG + Intronic
1159281224 18:66288562-66288584 TATCACATATGGCAGTTCCATGG - Intergenic
1160556113 18:79726646-79726668 TATCCCAAATGGCAGGAACAAGG - Intronic
1162871496 19:13590064-13590086 GAGCAAATATGGCAGCAACAAGG + Intronic
1168009268 19:53517472-53517494 TATCACAAATGACAGCAGGATGG - Intergenic
926991075 2:18680859-18680881 AATCACACATGACAACAATAAGG - Intergenic
928884046 2:36128476-36128498 CATCACGTATGGCTGCATTATGG - Intergenic
930571869 2:53096241-53096263 TATGAAATATGACAGCAAGAGGG + Intergenic
931248109 2:60507699-60507721 TAAGACATATGGCAGAAATGTGG + Intronic
933398639 2:81764150-81764172 TATCACTTATGGGTGCAAAAAGG - Intergenic
936698724 2:114984166-114984188 TATCACTTGTGGCAGCATAATGG - Intronic
937697655 2:124826202-124826224 TTTCAAATATGGTAGAAATATGG - Intronic
939842229 2:147203125-147203147 TATAACATAAGGCAGCAAATTGG - Intergenic
940359528 2:152782484-152782506 TATGATATATCACAGCAATAGGG - Intergenic
940574883 2:155490202-155490224 TATCACATGTGGTATCAATAAGG + Intergenic
940770587 2:157835461-157835483 TATCACAAAAGTCAGCATTATGG - Intronic
941553295 2:166942843-166942865 TAACACTTATGGCAGCAATTTGG - Intronic
941727531 2:168879466-168879488 TATCTGAGATGGCAGCAATTCGG + Intronic
946803715 2:223449092-223449114 TATCACAGATTGCAGGCATAGGG + Intergenic
1172957585 20:38771918-38771940 GGTCACATTTGGCAGCAAAATGG + Exonic
1173597105 20:44265718-44265740 TAATACATATGGCAGCTAAAGGG + Intronic
1178196710 21:30353463-30353485 CATCACGTATGGCAGCATTGAGG - Intronic
1178307702 21:31504181-31504203 TAACACATATGCCAGCAAGCAGG - Intronic
951622597 3:24621713-24621735 TATGAATTATGGCAGCAAAAAGG - Intergenic
952222403 3:31337593-31337615 TTTCATATATGGGAGAAATAGGG - Intergenic
953248389 3:41218855-41218877 TATTAAATATGGCTGCAATTCGG - Intronic
955940536 3:64143285-64143307 TGTCTAATATGGCAGCCATATGG - Intronic
956409156 3:68961098-68961120 TTTCACATATGGGATCAATCTGG - Intergenic
956985786 3:74698621-74698643 TATCATATATTACATCAATAGGG - Intergenic
956988457 3:74732619-74732641 TATCACCTTTGCCACCAATAAGG + Intergenic
959345884 3:105193892-105193914 TATCTCATATTACAGAAATATGG - Intergenic
965165891 3:165194511-165194533 TAAGACCTATGGGAGCAATAGGG - Intronic
968112762 3:196062690-196062712 TATCACATACAGTAGCATTAGGG + Intronic
974755597 4:66203157-66203179 TATCATATAATGCAGCAAAAAGG - Intergenic
977144187 4:93415208-93415230 TATAACATATTGCAGCTGTAAGG - Intronic
977344921 4:95805376-95805398 TATCACATATTGTTTCAATAAGG + Intergenic
978848825 4:113308759-113308781 TTTCAGAGATGGCAGAAATATGG + Intronic
984225858 4:177033867-177033889 TCACACATATGGCAGCAAGAAGG - Intergenic
984308663 4:178028648-178028670 TATCACAAGTGACAGCAATATGG - Intergenic
986589453 5:9353600-9353622 TATATCACATGGCATCAATAAGG + Intronic
986979313 5:13428606-13428628 TATCACATATTCCAGGGATAAGG + Intergenic
987907436 5:24094961-24094983 TAGTTCATATGCCAGCAATATGG - Intronic
988592487 5:32561193-32561215 TATCACAAGTGACAGCAAGATGG + Intronic
997213150 5:132089551-132089573 TATCACATATTGCACCACTCAGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001104232 5:168839597-168839619 TCTCACCTATGGGAGCAATATGG + Intronic
1001914029 5:175544459-175544481 TATCACAAGTGACAGCAAGATGG - Intergenic
1010378690 6:75203469-75203491 TAACAAATAAGGCAGCAAAATGG + Intronic
1010412477 6:75576206-75576228 TATCACATATTGCATATATATGG - Intergenic
1012144905 6:95669289-95669311 TATCACATGTGACAGCTTTATGG + Intergenic
1013915732 6:115335090-115335112 TATGACATATGTCAAGAATATGG - Intergenic
1014749288 6:125236978-125237000 TATCAAATATGGCACGAAAAGGG - Intronic
1020744733 7:12067330-12067352 TCTCACATACCGCAGCAATCAGG + Intergenic
1021028912 7:15704613-15704635 TATTACATAAGGCAGAATTATGG + Intergenic
1022018903 7:26379119-26379141 TATCACATAGTACAGCAATAAGG - Intergenic
1027815867 7:82970105-82970127 TATAACATATGCCTGCAAAAAGG + Intronic
1028201024 7:87961744-87961766 TTTCACAAATGGGAGAAATAGGG + Intronic
1032848641 7:135773356-135773378 TGAGACATATGACAGCAATAAGG + Intergenic
1041046413 8:53891023-53891045 TATCAAATGTGGCGGCCATATGG - Intronic
1041140554 8:54814021-54814043 TATCTCATATGGCTCCAGTAAGG + Intergenic
1043130470 8:76454787-76454809 TATCAAACAGGGCAGAAATAAGG + Intergenic
1043325811 8:79049705-79049727 TCTCTCATATGCCAGGAATAAGG + Intergenic
1043915843 8:85921288-85921310 TATCACTACTGGCAGCAATAAGG + Intergenic
1050254286 9:3777901-3777923 TATTACATAGGGCAGCACTAAGG + Intergenic
1050648908 9:7754166-7754188 TATAACATACGTCAGCAGTAAGG + Intergenic
1051512088 9:17889345-17889367 TATCACTTACCACAGCAATAAGG + Intergenic
1051765812 9:20522517-20522539 TATCACATATGACCTCAAAAGGG - Intronic
1055873010 9:80907318-80907340 AATCACATATGGCATTATTATGG + Intergenic
1057315526 9:93966104-93966126 GGTCTCATAAGGCAGCAATAAGG - Intergenic
1058604125 9:106702539-106702561 TTTTTCATATGGCGGCAATAGGG - Intergenic
1058974641 9:110114675-110114697 TAAAACCTATGGCAGCAAAACGG + Intronic
1061477393 9:130877514-130877536 TACCACATATCCCAGCAAGATGG + Intronic
1186015771 X:5191614-5191636 TATAGCATATTGCAGCAGTATGG - Intergenic
1186283449 X:8018988-8019010 TATGAAATATGGAACCAATAGGG + Intergenic
1187355075 X:18560968-18560990 TATCACATAAGGCATCAAATGGG - Intronic
1191598656 X:62976323-62976345 TATTTCAAATAGCAGCAATATGG - Intergenic
1196415448 X:115466322-115466344 TAAAACATATAGCAGAAATATGG + Intergenic
1196432308 X:115639593-115639615 CTTCACATATGGCAGGATTAAGG + Intronic
1201420642 Y:13794845-13794867 CATCACATATGGGCACAATATGG - Intergenic
1201441178 Y:14010125-14010147 TATGAAATATGGAACCAATAGGG + Intergenic
1201443393 Y:14032583-14032605 TATGAAATATGGAACCAATAGGG - Intergenic
1202259323 Y:22953627-22953649 ACTCACATATGGCTGCACTAGGG + Intergenic
1202412309 Y:24587371-24587393 ACTCACATATGGCTGCACTAGGG + Intergenic
1202458471 Y:25082699-25082721 ACTCACATATGGCTGCACTAGGG - Intergenic