ID: 1070380754

View in Genome Browser
Species Human (GRCh38)
Location 10:75878488-75878510
Sequence AAAGGCCTTGTGGTGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070380748_1070380754 6 Left 1070380748 10:75878459-75878481 CCTGACTGAATTCTGCGTCATCC 0: 1
1: 1
2: 1
3: 9
4: 83
Right 1070380754 10:75878488-75878510 AAAGGCCTTGTGGTGTCTGCTGG No data
1070380747_1070380754 7 Left 1070380747 10:75878458-75878480 CCCTGACTGAATTCTGCGTCATC 0: 1
1: 1
2: 0
3: 10
4: 108
Right 1070380754 10:75878488-75878510 AAAGGCCTTGTGGTGTCTGCTGG No data
1070380746_1070380754 8 Left 1070380746 10:75878457-75878479 CCCCTGACTGAATTCTGCGTCAT 0: 1
1: 1
2: 0
3: 10
4: 91
Right 1070380754 10:75878488-75878510 AAAGGCCTTGTGGTGTCTGCTGG No data
1070380744_1070380754 28 Left 1070380744 10:75878437-75878459 CCTCAGACCGTCACTGACTGCCC 0: 1
1: 0
2: 0
3: 11
4: 192
Right 1070380754 10:75878488-75878510 AAAGGCCTTGTGGTGTCTGCTGG No data
1070380745_1070380754 21 Left 1070380745 10:75878444-75878466 CCGTCACTGACTGCCCCTGACTG 0: 1
1: 0
2: 3
3: 31
4: 271
Right 1070380754 10:75878488-75878510 AAAGGCCTTGTGGTGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070380754 Original CRISPR AAAGGCCTTGTGGTGTCTGC TGG Intronic
No off target data available for this crispr