ID: 1070381650

View in Genome Browser
Species Human (GRCh38)
Location 10:75885456-75885478
Sequence CATGTCATGCTTAAGCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070381650_1070381653 15 Left 1070381650 10:75885456-75885478 CCTTTCAGCTTAAGCATGACATG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1070381653 10:75885494-75885516 GGCCCAGTTATAGAAGCTCCTGG No data
1070381650_1070381652 -6 Left 1070381650 10:75885456-75885478 CCTTTCAGCTTAAGCATGACATG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1070381652 10:75885473-75885495 GACATGTTCTGTAACTAAGGAGG No data
1070381650_1070381651 -9 Left 1070381650 10:75885456-75885478 CCTTTCAGCTTAAGCATGACATG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1070381651 10:75885470-75885492 CATGACATGTTCTGTAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070381650 Original CRISPR CATGTCATGCTTAAGCTGAA AGG (reversed) Intronic
901661020 1:10797736-10797758 CATCCCACGCTTATGCTGAAGGG - Intergenic
904297952 1:29534521-29534543 CAGGTCTTGCTTAAGCCCAAAGG - Intergenic
907499953 1:54871778-54871800 CATGTCATGTCGAAGCTGCAGGG - Intronic
909817770 1:80017811-80017833 CATGTCATCCTGTAGCAGAAGGG - Intergenic
911330951 1:96525219-96525241 GAAGTCATGTTTAAGCTGAAAGG + Intergenic
911561726 1:99414736-99414758 CAAGTCAAGCCTCAGCTGAAGGG - Intergenic
913044847 1:115065146-115065168 CATTGCTTGCTGAAGCTGAAGGG + Intronic
914327536 1:146635010-146635032 AATGGTATGCTTACGCTGAAAGG - Intergenic
919611660 1:199752487-199752509 CAGGTCATCCTTAATCAGAAAGG + Intergenic
920123049 1:203673086-203673108 CATGTCAGCCTGGAGCTGAAGGG + Intronic
920123188 1:203673895-203673917 CATGTCATGCTTATGGAGAGGGG - Intronic
1068010009 10:51436510-51436532 AATGTCTTGCTTATGCTCAATGG - Intronic
1068013063 10:51478704-51478726 CATGTTATGCTTAAGCTTCATGG - Intronic
1068884623 10:62086069-62086091 CATCTCATGAGCAAGCTGAAAGG - Intronic
1070381650 10:75885456-75885478 CATGTCATGCTTAAGCTGAAAGG - Intronic
1071196185 10:83162927-83162949 CATATCCTGTCTAAGCTGAATGG + Intergenic
1071779773 10:88830917-88830939 CAAGTCATGCCTGTGCTGAATGG - Intronic
1078423255 11:11229387-11229409 CTTGTCATTCTTAGGCTGGAGGG - Intergenic
1079709412 11:23662911-23662933 AATGTCATGGTTAAGTTAAAAGG - Intergenic
1081620287 11:44615264-44615286 CATCTCCTGCTTCAGCTGCAGGG - Exonic
1085021130 11:73209031-73209053 CATGTCATGCTACAGCAGGAAGG + Intergenic
1086030542 11:82349878-82349900 AAAGTCATGCTTGTGCTGAAAGG + Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087118506 11:94548054-94548076 CAAGTCAAGCTTAATCTAAATGG - Exonic
1091017741 11:132067911-132067933 CATGTCCAGCTTAGACTGAAAGG - Intronic
1091029905 11:132176611-132176633 CATGTCAAGCATAATCTGAGAGG - Intronic
1091687203 12:2571899-2571921 CATTTCAAGGTTCAGCTGAAGGG - Intronic
1095268692 12:40190678-40190700 CATGACATGCTTCAACTGTATGG + Intergenic
1098552583 12:71779567-71779589 CATATTATGCTTAGACTGAATGG - Intronic
1099873700 12:88379058-88379080 GTTGTCATGCTTTATCTGAAAGG + Intergenic
1100599056 12:96097235-96097257 CATGTCACTCCTAAGCTCAAAGG - Intergenic
1104094448 12:125544236-125544258 CATGCCAGGCTTAAGGTGATGGG + Intronic
1104590267 12:130079081-130079103 CATGACTTCCTTAAGCTGCAAGG + Intergenic
1104601245 12:130154941-130154963 CATGACATGCGTGAGCTGTAAGG + Intergenic
1105038300 12:132942466-132942488 CATGTCATGGATAAACAGAATGG + Intronic
1105876831 13:24562400-24562422 CATTTCAACCTTAGGCTGAAAGG - Intergenic
1107096121 13:36538301-36538323 AATGTCCTGGTTAAGCAGAAAGG + Intergenic
1109291445 13:60480335-60480357 CTTGTGAGGTTTAAGCTGAAAGG + Intronic
1117271949 14:54153598-54153620 CATATCATACTTAAGGTTAATGG + Intergenic
1118315664 14:64724507-64724529 CAGGTCATGGGTAAGCAGAAAGG - Intronic
1118469264 14:66059864-66059886 GATGGCATGCCTAAGCTCAATGG + Intergenic
1124259809 15:28178484-28178506 CAGTTCATGCCTATGCTGAACGG - Intronic
1125284869 15:38081801-38081823 CAAGTCATGCTAAAACTTAATGG + Intergenic
1125577393 15:40764887-40764909 CATGTCTTTCTGAAGCTAAAAGG - Intronic
1126453370 15:48834627-48834649 CATGTCCTGCTCCAGCTGGAAGG + Intronic
1130003213 15:80066243-80066265 GATGTCATGTTTAAGTTGATTGG + Intronic
1134041972 16:11076001-11076023 TATGTGATGCTTAAGCTGGCAGG - Intronic
1138646397 16:58428496-58428518 CATGTGATGCAGAAGCAGAAGGG + Intergenic
1138909022 16:61374197-61374219 CATGTAATGTTTCAGCTGGAAGG - Intergenic
1140006023 16:71075930-71075952 AATGGTATGCTTACGCTGAAAGG + Intronic
1144005557 17:11096108-11096130 AGTGTCCTGCTTAAGATGAAAGG - Intergenic
1146577600 17:34008512-34008534 CATGCCATGATTAGGCAGAAAGG + Intronic
1146727302 17:35166717-35166739 CATGGGATGCTCAAGCTGGAGGG + Intronic
1158616390 18:58991630-58991652 CATGTCATGCTTAATTGGATTGG + Intergenic
1166969894 19:46559288-46559310 AAGGTCATCCTTGAGCTGAATGG + Intronic
925027348 2:620455-620477 CAATTCATTTTTAAGCTGAACGG - Intergenic
927132613 2:20073227-20073249 CACCACATGCTCAAGCTGAAAGG + Intergenic
930394130 2:50798407-50798429 CATGTGGTGCTGAAACTGAATGG - Intronic
932527091 2:72482110-72482132 CATATTATGCTTATGCTAAAAGG - Intronic
936628381 2:114173593-114173615 CATGGCATTCTTTAGTTGAATGG - Intergenic
940163065 2:150735307-150735329 AATGTAATGCATAACCTGAATGG - Intergenic
942409086 2:175687893-175687915 CATGTTAGGCTTAAGCTACAGGG + Intergenic
945325280 2:208474661-208474683 CATGTCATGCTAAAGCACATTGG + Intronic
1171133198 20:22674075-22674097 TATGACATCCTGAAGCTGAAGGG + Intergenic
1172268514 20:33638461-33638483 TAATTCATGCTTAAGCTGAGGGG + Intronic
1172277694 20:33688968-33688990 CAGGTCCTGCTGAAGCAGAAAGG + Intergenic
1178730330 21:35096176-35096198 CTTGACATGCTTATGTTGAAGGG - Intronic
1178946185 21:36949684-36949706 CATGTCATTCTCATGCAGAAGGG - Intronic
1179905517 21:44420724-44420746 CATGTCAGGATGAAGCTGGAAGG + Intronic
950341754 3:12252991-12253013 TATGTCATCCTTAAGATGACAGG + Intergenic
950401170 3:12769865-12769887 CATGTTATTCTTAATCAGAAGGG - Intergenic
952512874 3:34074775-34074797 CAGGACATGCTGAAGCTAAAAGG + Intergenic
953785138 3:45905813-45905835 CATGTCATGCAAATGCTAAATGG - Intronic
953785249 3:45906557-45906579 CATGTCATGCAAATGCTAAATGG + Intronic
962160709 3:132997015-132997037 CTTGTCTTGCTTGACCTGAATGG - Intergenic
968722588 4:2218603-2218625 CATTTCTTGCTTATGCTGATTGG + Intronic
972846890 4:43001911-43001933 TATGTCATACTTAAGTTCAAGGG + Intronic
975280700 4:72558752-72558774 TATGACATGGTTAACCTGAAGGG - Intronic
977919922 4:102631778-102631800 CATGTCCTGCTAAAGCTGAGAGG + Intronic
979714124 4:123816651-123816673 CATGTTATTCTAAATCTGAAAGG + Intergenic
979889942 4:126078812-126078834 CCTTTCATGATTAATCTGAAAGG + Intergenic
980902910 4:138922070-138922092 GATGTCATCTTAAAGCTGAATGG + Intergenic
982642110 4:157975014-157975036 CATGTCTTGCATCACCTGAAGGG + Intergenic
986849555 5:11795272-11795294 TATGTCATGGCTCAGCTGAAGGG - Intronic
989047162 5:37284332-37284354 CAAGTCATGCCTTACCTGAATGG + Intergenic
992547985 5:77834012-77834034 TAGTTGATGCTTAAGCTGAAAGG - Intronic
994408593 5:99378052-99378074 AATGTCATGCATGAACTGAAAGG - Intergenic
999633284 5:153593734-153593756 CAGGTCAGGCTTCAGCTGAATGG - Intronic
1003748617 6:9030620-9030642 CAAGTCATGCTTTACCTGGATGG - Intergenic
1007875032 6:45088285-45088307 CATGACATGCTAAAGCAGAAGGG + Intronic
1010754838 6:79655363-79655385 CAAGTAATGCTTAAGCTTAAGGG - Intronic
1012102279 6:95105033-95105055 AAGGTCATTCTTGAGCTGAATGG - Intergenic
1012536175 6:100300089-100300111 AATGTCAGGATTAAACTGAATGG - Intergenic
1015080656 6:129222055-129222077 CATGTCAGGGTTATGCTGCAGGG + Intronic
1015659342 6:135557768-135557790 CATGTGAAGCTTAATCTGGACGG + Intergenic
1016133303 6:140505161-140505183 CATGTCATACTTCATTTGAATGG - Intergenic
1018343598 6:162878826-162878848 CATGTTATTCTAAATCTGAATGG + Intronic
1020291339 7:6724724-6724746 CATGTGATCCTCATGCTGAAAGG - Intergenic
1020880065 7:13750074-13750096 CATTTCATTTTTCAGCTGAATGG + Intergenic
1024214091 7:47232109-47232131 CATGGCAGGCATAAGCTGAATGG + Intergenic
1026087698 7:67275958-67275980 CATGTGATCCTCATGCTGAAAGG + Intergenic
1026726536 7:72874273-72874295 CATGTGATCCTCATGCTGAAAGG - Intergenic
1026748412 7:73030722-73030744 CATGTGATCCTCATGCTGAAAGG - Intergenic
1026752060 7:73058867-73058889 CATGTGATCCTCATGCTGAAAGG - Intergenic
1026755710 7:73086994-73087016 CATGTGATCCTCATGCTGAAAGG - Intergenic
1027034614 7:74916037-74916059 CATGTGATCCTCATGCTGAAAGG - Intergenic
1027091691 7:75306396-75306418 CATGTGATCCTCATGCTGAAAGG + Intergenic
1027095334 7:75334362-75334384 CATGTGATCCTCATGCTGAAAGG + Intergenic
1027117306 7:75491337-75491359 CATGTGATCCTCATGCTGAAAGG + Intergenic
1027274503 7:76544265-76544287 CATGTGATCCTCATGCTGAAAGG - Intergenic
1027324006 7:77033317-77033339 CATGTGATCCTCATGCTGAAAGG - Intergenic
1028221136 7:88198224-88198246 CATATCATGCCCAAACTGAAGGG + Intronic
1029395442 7:100305092-100305114 CATGTGATCCTCATGCTGAAAGG + Intergenic
1029720199 7:102358722-102358744 CATGTGATCCTCATGCTGAAAGG - Intergenic
1034445770 7:151113529-151113551 CATGGAATTCTAAAGCTGAAAGG + Intronic
1036654526 8:10669373-10669395 CATGGCAGGCTTGAGCTTAATGG - Intronic
1045613773 8:103880900-103880922 AATGTTATGCTTAAACTGCATGG + Intronic
1045716435 8:105052116-105052138 CATGACATATTAAAGCTGAAAGG + Intronic
1046406018 8:113773690-113773712 CATTACTTGCTGAAGCTGAAGGG - Intergenic
1050056780 9:1663834-1663856 CAAGTCATTCTTATGATGAATGG + Intergenic
1056674176 9:88659391-88659413 CCTGTCATGCGTATTCTGAAGGG - Intergenic
1061004193 9:127919102-127919124 GAGGTGATGCTTGAGCTGAATGG - Intergenic
1062635799 9:137490570-137490592 CATGTCACCCTCATGCTGAAGGG - Intronic
1186344101 X:8673560-8673582 CATGTCATGCTAAATCTAGAAGG - Intronic
1188253084 X:27923732-27923754 CATGTCATAATCAAGCAGAAAGG - Intergenic
1192833949 X:74779643-74779665 TCTGTCTTTCTTAAGCTGAAAGG + Intronic
1194358779 X:92920612-92920634 CATACCATGCTGAAGCTGCAGGG + Intergenic
1195067983 X:101254686-101254708 CAGGTCAGGCCCAAGCTGAACGG - Intronic
1196129775 X:112142736-112142758 TATTTCTTGTTTAAGCTGAATGG + Intergenic
1198422756 X:136484079-136484101 CTTGTCATGATTAAACTTAATGG - Intergenic
1198715554 X:139554597-139554619 CATGTCATGGTTAATCTGCAGGG + Intronic
1200666945 Y:6036306-6036328 CATACCATGCTGAAGCTGCAGGG + Intergenic