ID: 1070389710

View in Genome Browser
Species Human (GRCh38)
Location 10:75958845-75958867
Sequence GGTGGAAGGCTGAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070389706_1070389710 -4 Left 1070389706 10:75958826-75958848 CCTCACAATCGTGGCAGAAGGTG 0: 21
1: 856
2: 1548
3: 3988
4: 4296
Right 1070389710 10:75958845-75958867 GGTGGAAGGCTGAAGGTGAAAGG No data
1070389703_1070389710 13 Left 1070389703 10:75958809-75958831 CCACATGGCTGGGGAGGCCTCAC 0: 2581
1: 6120
2: 6975
3: 5143
4: 2945
Right 1070389710 10:75958845-75958867 GGTGGAAGGCTGAAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070389710 Original CRISPR GGTGGAAGGCTGAAGGTGAA AGG Intronic
No off target data available for this crispr