ID: 1070389710 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:75958845-75958867 |
| Sequence | GGTGGAAGGCTGAAGGTGAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1070389706_1070389710 | -4 | Left | 1070389706 | 10:75958826-75958848 | CCTCACAATCGTGGCAGAAGGTG | 0: 21 1: 856 2: 1548 3: 3988 4: 4296 |
||
| Right | 1070389710 | 10:75958845-75958867 | GGTGGAAGGCTGAAGGTGAAAGG | No data | ||||
| 1070389703_1070389710 | 13 | Left | 1070389703 | 10:75958809-75958831 | CCACATGGCTGGGGAGGCCTCAC | 0: 2581 1: 6120 2: 6975 3: 5143 4: 2945 |
||
| Right | 1070389710 | 10:75958845-75958867 | GGTGGAAGGCTGAAGGTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1070389710 | Original CRISPR | GGTGGAAGGCTGAAGGTGAA AGG | Intronic | ||
| No off target data available for this crispr | |||||