ID: 1070390733

View in Genome Browser
Species Human (GRCh38)
Location 10:75968213-75968235
Sequence CTGTCCTTACAGCTCTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070390733_1070390746 20 Left 1070390733 10:75968213-75968235 CCCCACTAGAGCTGTAAGGACAG 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1070390746 10:75968256-75968278 GGCTGCTCATAGAAGTTGTGGGG No data
1070390733_1070390739 -6 Left 1070390733 10:75968213-75968235 CCCCACTAGAGCTGTAAGGACAG 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1070390739 10:75968230-75968252 GGACAGAGGGACCCTTCCGGAGG No data
1070390733_1070390745 19 Left 1070390733 10:75968213-75968235 CCCCACTAGAGCTGTAAGGACAG 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1070390745 10:75968255-75968277 TGGCTGCTCATAGAAGTTGTGGG No data
1070390733_1070390744 18 Left 1070390733 10:75968213-75968235 CCCCACTAGAGCTGTAAGGACAG 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1070390744 10:75968254-75968276 GTGGCTGCTCATAGAAGTTGTGG No data
1070390733_1070390740 -1 Left 1070390733 10:75968213-75968235 CCCCACTAGAGCTGTAAGGACAG 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1070390740 10:75968235-75968257 GAGGGACCCTTCCGGAGGAGTGG No data
1070390733_1070390738 -9 Left 1070390733 10:75968213-75968235 CCCCACTAGAGCTGTAAGGACAG 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1070390738 10:75968227-75968249 TAAGGACAGAGGGACCCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070390733 Original CRISPR CTGTCCTTACAGCTCTAGTG GGG (reversed) Intronic
900660163 1:3778145-3778167 GTGTCCTTACAGCTCTGGGAGGG + Intergenic
901936919 1:12633219-12633241 CTGTGCTTTCAGCTCTAATTGGG + Intergenic
906071997 1:43023834-43023856 CTTTTCTGACAGCTCTAGGGAGG - Intergenic
906656911 1:47554790-47554812 CTGTCCTCACAGGGCTACTGCGG + Intergenic
915594405 1:156888015-156888037 CTGTGATTACAGCTACAGTGGGG + Intergenic
916570478 1:166021608-166021630 CTTTGCTTACAGCTCTACAGTGG + Intergenic
917660136 1:177170259-177170281 TTGTCCTTACAGTCCTGGTGTGG + Intergenic
918326551 1:183416816-183416838 CTGTCTTTACCGCTGTGGTGTGG + Intronic
918868466 1:189934821-189934843 CTGGCCTTACAGCATTAGTGGGG + Intergenic
919431913 1:197504426-197504448 CTGTCCTTAAACCTTAAGTGGGG + Intergenic
921261405 1:213388212-213388234 CTGTCCTTGCTCCTTTAGTGGGG - Intergenic
921552976 1:216561577-216561599 CAGTCCATATAGCTGTAGTGTGG + Intronic
1069874306 10:71552297-71552319 CTGTCCCTCCAGCTCTCATGTGG - Intronic
1070390733 10:75968213-75968235 CTGTCCTTACAGCTCTAGTGGGG - Intronic
1070787841 10:79172328-79172350 CTGTCCTAGAAGCTCTAGGGAGG - Intronic
1072714252 10:97738766-97738788 CTGTCCTTTCTGCCCTAGTGAGG + Intronic
1072798080 10:98371961-98371983 CTCTCCTAACACCTCGAGTGTGG - Intergenic
1074979199 10:118605842-118605864 CGGTGCTTACAGCTCGAGAGTGG - Intergenic
1079608765 11:22404219-22404241 CTGTCCATAGAGCTGTAGTTAGG - Intergenic
1085497550 11:76984935-76984957 CTGTCCTTCCAGTTCTAGTAAGG - Intronic
1087145747 11:94809508-94809530 CTGTCCCTACAGCCCGTGTGAGG - Intronic
1087762315 11:102113872-102113894 TTGCCCTTACATGTCTAGTGTGG + Intronic
1088233363 11:107696863-107696885 CTGTCTTCACAGCTCTCGGGTGG - Intergenic
1090378916 11:126311437-126311459 CTGTCTTTGCAGTTCTAGTGGGG + Intronic
1090823303 11:130364472-130364494 CTGTTCTTTCATCTGTAGTGTGG + Intergenic
1091529797 12:1343141-1343163 CAGGCTTTACAGCTCTACTGGGG + Intronic
1091535847 12:1408614-1408636 CTTTCCTTACAAGCCTAGTGAGG + Intronic
1092057415 12:5519472-5519494 ATGTCCCCACAGCTTTAGTGTGG - Intronic
1092082230 12:5725719-5725741 CTGTCCTTGCAGCCCTAAGGTGG + Intronic
1094067680 12:26378631-26378653 CTGTCCTTCTAGTTATAGTGTGG + Intronic
1097156434 12:57015608-57015630 CTGTCTGGACAGCTGTAGTGAGG - Intronic
1099284963 12:80706401-80706423 GTTTCCTTACAGTTTTAGTGAGG - Intergenic
1105406899 13:20140667-20140689 CTGTCAGGACAGCTCTGGTGTGG + Exonic
1108050071 13:46426316-46426338 CTGTACTTTCTGCTCTATTGTGG - Intronic
1108305701 13:49130134-49130156 GTGTCTTTGCAGCTCTAGTAAGG + Intronic
1109542593 13:63799625-63799647 CTGTACTTTCTGCTCTATTGTGG - Intergenic
1110364464 13:74666126-74666148 TTGTCCTTACTGTTCTAGTTGGG - Intergenic
1111902989 13:94222485-94222507 GTTTTCTGACAGCTCTAGTGGGG + Intronic
1115517234 14:34198168-34198190 TTGCCCTTTCAGCTCTAGGGTGG - Intronic
1117866702 14:60157562-60157584 CTTTCCATACAGTTCTGGTGAGG - Intronic
1119535648 14:75400622-75400644 GTGTCGTTACAGCTCTCCTGGGG - Intergenic
1121090411 14:91177651-91177673 ATGTGCTTACAGCGCAAGTGTGG - Intronic
1127706501 15:61552423-61552445 CTGTCATTCCAGGTCTAGTTTGG - Intergenic
1127999181 15:64175013-64175035 CTGTGCTTGGAACTCTAGTGGGG - Intronic
1134778894 16:16877572-16877594 CTCTCCCTCCAGCTCTAGGGTGG + Intergenic
1139045917 16:63059915-63059937 CAGTCCTTCCAGCTCTTGTTAGG + Intergenic
1140799724 16:78475124-78475146 ATGTCCCTACAGCTATATTGAGG - Intronic
1141697130 16:85625446-85625468 CTGTCCTCAAAACTGTAGTGTGG + Intronic
1142033435 16:87849777-87849799 CTGTCCTGCCAGCTCTTGGGTGG + Intronic
1143103034 17:4514496-4514518 CTGTCCTTACAGCCCAGATGGGG + Intronic
1144456632 17:15424035-15424057 CTGTCCATTCTGCTCTGGTGTGG + Intergenic
1144460350 17:15453603-15453625 CTCTCTTTACTGTTCTAGTGAGG + Intronic
1149462519 17:56841915-56841937 CTGTAGTCCCAGCTCTAGTGAGG - Intronic
1150929345 17:69567339-69567361 CTGTCCATTCAGCACCAGTGAGG - Intergenic
1151483511 17:74384281-74384303 CTGTCCTTACAGGGCTCGAGTGG + Intergenic
1159975231 18:74703231-74703253 CTTTCCTTACACATCTAGTTGGG - Intronic
1162916019 19:13874822-13874844 CTGACCTTCCAGATCTAGGGGGG + Intronic
1163189997 19:15670619-15670641 CTGTCCTTGCAGAGGTAGTGGGG + Intergenic
1165386645 19:35513989-35514011 CTGTCCTTACTCCTTTGGTGGGG - Intergenic
1167500614 19:49845033-49845055 CTGTCCTCTCAGCTTGAGTGTGG - Intergenic
1167663702 19:50811398-50811420 TTGTCCTCACAGCCCTAGAGTGG - Intergenic
928319606 2:30272606-30272628 CTGTCCTTACAGGGCCAGTAGGG + Intronic
929943875 2:46355944-46355966 CTGTCCTCACAGCTCCCGTCAGG + Intronic
932053016 2:68417666-68417688 CTGGCCTTACAGCTTTAGAAAGG + Intergenic
935176740 2:100655478-100655500 CTGTCCCTGCAGAGCTAGTGAGG - Intergenic
935310833 2:101781638-101781660 CTGGCCTTACACCTCTCATGAGG + Intronic
935979926 2:108616508-108616530 CTGTCATTAAAGCTCATGTGAGG - Intronic
936092838 2:109512072-109512094 CTTTCTCTACAACTCTAGTGGGG + Intergenic
938385033 2:130859456-130859478 CAGTCCTTACAGGCCGAGTGTGG + Intronic
938385414 2:130862932-130862954 CAGTCCTTACAGGCCGAGTGTGG + Intronic
941461842 2:165781342-165781364 CTGTAATTACAGCACTACTGAGG + Intronic
1170885506 20:20337214-20337236 CCATCCTAACAGGTCTAGTGAGG - Intronic
1172941049 20:38654965-38654987 CTGTCCTCTCTGCTCTCGTGGGG - Intergenic
1173979483 20:47212183-47212205 AAGTCCTTCCAGCTCTGGTGAGG + Intronic
1179507196 21:41849444-41849466 CTGTAATTACAGCTCTTGAGAGG + Intronic
1179532857 21:42032067-42032089 CTTTCCTTACAGATGTTGTGAGG + Intergenic
1183070077 22:35390094-35390116 CTGTCCTTACAGGGGCAGTGGGG - Intronic
1183786563 22:40032312-40032334 CTGTGCTTACTGCCCTTGTGGGG - Exonic
949426193 3:3918718-3918740 CTGCTCTTACAGCTCTTTTGTGG - Intronic
950794938 3:15503138-15503160 CTGTCCTCACTGCTCTAGTCTGG + Intronic
951777560 3:26326238-26326260 CTGTCATAACAGTTCTAGAGCGG - Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
956613114 3:71144467-71144489 CTTTCTTTACAGCTCAGGTGTGG - Intronic
960439856 3:117673627-117673649 CTATTGTTACTGCTCTAGTGGGG - Intergenic
962957558 3:140280038-140280060 CTTTGCTTACAGCCCTGGTGCGG + Intronic
965698073 3:171429889-171429911 CTGTCCTTACCACTCCTGTGTGG + Intronic
976067139 4:81200683-81200705 GTGTCCTTACTTCTCTAGTAAGG + Intronic
977002330 4:91519371-91519393 CTGTCCTGAGAGCCCCAGTGAGG + Intronic
980496740 4:133594830-133594852 CTTCCTTTACAGCTCTACTGTGG + Intergenic
983635430 4:169893172-169893194 GTGTCCTCTCAGCTCTGGTGTGG + Intergenic
984131949 4:175887899-175887921 CTCTCCTTAAAGCTTTAATGGGG - Intronic
985384288 4:189429184-189429206 GAGTCCGTACAGCTGTAGTGGGG - Intergenic
987068543 5:14313608-14313630 CTGTCATTCCAGGGCTAGTGTGG + Intronic
989558096 5:42820375-42820397 CTGTCTCTTCAGCTCTTGTGTGG - Intronic
990972483 5:61524293-61524315 CTATCCATCCACCTCTAGTGAGG + Intronic
994192130 5:96880417-96880439 CTGTCTTTACATCTCTACTGTGG - Intronic
996040650 5:118806536-118806558 CTCTCCTGGCAGCACTAGTGAGG - Intergenic
997863316 5:137439273-137439295 CTGTCCTTATAGAACTAGTTAGG - Intronic
997889990 5:137667511-137667533 CTGTGCTTACATCTGAAGTGTGG - Intronic
998616133 5:143742669-143742691 CTTTCCTTACAGCAAAAGTGAGG - Intergenic
1001793321 5:174480209-174480231 CTGTCCTGCCAGCTGTACTGTGG - Intergenic
1007621194 6:43215810-43215832 CCATCCTTACTGCTCAAGTGTGG - Intronic
1008892152 6:56507418-56507440 CTGTCTTTCCTGCTGTAGTGTGG - Intronic
1011389972 6:86841209-86841231 AAGTCCGTACAGCTCTAGAGAGG - Intergenic
1014099479 6:117495025-117495047 CTGACCTTGCAGCTCTTTTGAGG + Intronic
1016356599 6:143225163-143225185 CTGTCCTTTCTGCTGAAGTGTGG + Intronic
1017872844 6:158501841-158501863 CTGTCCCTACAGCTGTCGTCTGG - Exonic
1019724238 7:2592199-2592221 CTGTCCTTACCCCTCACGTGAGG + Intronic
1020733493 7:11914870-11914892 ATGTGCTTCCAGCTCTAGAGGGG + Intergenic
1022265914 7:28754690-28754712 ATGTTCTCACAGCTCTAATGAGG - Intronic
1023775844 7:43606145-43606167 TGGTCCTTCAAGCTCTAGTGGGG - Intronic
1024885890 7:54141638-54141660 CTCTCCCTAAAGATCTAGTGGGG + Intergenic
1025191158 7:56897036-56897058 CTCTACATAAAGCTCTAGTGGGG - Intergenic
1025680790 7:63679894-63679916 CTCTACATAAAGCTCTAGTGGGG + Intergenic
1027390741 7:77701216-77701238 CTGTCCTTACTGCTTTAGCCTGG + Intronic
1028185952 7:87785388-87785410 CTGTGGTTACAGCTCTAGTGAGG - Intronic
1033532082 7:142274493-142274515 CTGGCATGACAGCTCTGGTGAGG + Intergenic
1034737038 7:153439103-153439125 CTCTCCTTACTGCTCTCTTGTGG + Intergenic
1037141896 8:15530183-15530205 CTGTCCTTATAGCTGCTGTGTGG - Intronic
1039506502 8:38056374-38056396 CTGTCCTTACAGCACTCCTGTGG - Intronic
1041475149 8:58256782-58256804 CTGTGTCTACTGCTCTAGTGTGG - Intergenic
1042183502 8:66114305-66114327 CTGACTTTTCAGCTCTAGTTTGG - Intergenic
1042209901 8:66369646-66369668 CTGTCTTTATCGCTCTAGGGAGG - Intergenic
1045505718 8:102777008-102777030 TTGTCCTTACAACTCCAGTTTGG + Intergenic
1045540418 8:103079126-103079148 ATCTCCTTGCAGCTCTAATGTGG - Intergenic
1046516517 8:115269177-115269199 CTGGCCTGACACCTATAGTGTGG + Intergenic
1048953560 8:139515476-139515498 CTGTTCTTACAGCACTAATAAGG + Intergenic
1056068171 9:82958473-82958495 GTGGCCTTAAATCTCTAGTGTGG + Intergenic
1056329869 9:85512256-85512278 CTTTCCTTACAGCAGCAGTGTGG - Intergenic
1057161777 9:92894346-92894368 CTGTCTTTTCAGCGCTGGTGGGG + Intergenic
1059824628 9:118014999-118015021 GTGTCCTTACAGGTAAAGTGAGG + Intergenic
1059860996 9:118461578-118461600 TTGTCTTTACTGCTATAGTGTGG - Intergenic
1192191523 X:68994184-68994206 CAGTCCTTACATCTCTAGCTCGG - Intergenic
1200097313 X:153670282-153670304 CTGTCCTTCCACCTCTCCTGGGG + Intronic