ID: 1070394737

View in Genome Browser
Species Human (GRCh38)
Location 10:76002350-76002372
Sequence ATTTGAGGAGGTTGCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070394726_1070394737 24 Left 1070394726 10:76002303-76002325 CCACTTCAAACTACTGTCACATT No data
Right 1070394737 10:76002350-76002372 ATTTGAGGAGGTTGCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070394737 Original CRISPR ATTTGAGGAGGTTGCGGGGT GGG Intronic