ID: 1070395270

View in Genome Browser
Species Human (GRCh38)
Location 10:76006705-76006727
Sequence GGCTGGATTGTTTTTGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070395264_1070395270 12 Left 1070395264 10:76006670-76006692 CCATTAGTCAGTCGCTCTGACTT No data
Right 1070395270 10:76006705-76006727 GGCTGGATTGTTTTTGAAAGGGG No data
1070395263_1070395270 13 Left 1070395263 10:76006669-76006691 CCCATTAGTCAGTCGCTCTGACT No data
Right 1070395270 10:76006705-76006727 GGCTGGATTGTTTTTGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070395270 Original CRISPR GGCTGGATTGTTTTTGAAAG GGG Intronic