ID: 1070403266

View in Genome Browser
Species Human (GRCh38)
Location 10:76072281-76072303
Sequence ATCCCTCTCCACCACTTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070403260_1070403266 10 Left 1070403260 10:76072248-76072270 CCCTGGACAGGGAGTCCAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1070403266 10:76072281-76072303 ATCCCTCTCCACCACTTAAAGGG No data
1070403264_1070403266 -5 Left 1070403264 10:76072263-76072285 CCAGAGATTTGGGCTCTAATCCC No data
Right 1070403266 10:76072281-76072303 ATCCCTCTCCACCACTTAAAGGG No data
1070403261_1070403266 9 Left 1070403261 10:76072249-76072271 CCTGGACAGGGAGTCCAGAGATT 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1070403266 10:76072281-76072303 ATCCCTCTCCACCACTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070403266 Original CRISPR ATCCCTCTCCACCACTTAAA GGG Intronic
No off target data available for this crispr