ID: 1070406610

View in Genome Browser
Species Human (GRCh38)
Location 10:76103367-76103389
Sequence TGATGAGGAAACTCTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070406610_1070406618 26 Left 1070406610 10:76103367-76103389 CCAGTGGGAGAGTTTCCTCATCA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1070406618 10:76103416-76103438 GACTGCTCTTCTGATCCCGGGGG No data
1070406610_1070406615 23 Left 1070406610 10:76103367-76103389 CCAGTGGGAGAGTTTCCTCATCA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1070406615 10:76103413-76103435 CTTGACTGCTCTTCTGATCCCGG No data
1070406610_1070406616 24 Left 1070406610 10:76103367-76103389 CCAGTGGGAGAGTTTCCTCATCA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1070406616 10:76103414-76103436 TTGACTGCTCTTCTGATCCCGGG No data
1070406610_1070406617 25 Left 1070406610 10:76103367-76103389 CCAGTGGGAGAGTTTCCTCATCA 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1070406617 10:76103415-76103437 TGACTGCTCTTCTGATCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070406610 Original CRISPR TGATGAGGAAACTCTCCCAC TGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
902846173 1:19112261-19112283 TCTTGAGGAAACTCTCCCTGAGG - Intronic
904342107 1:29843255-29843277 TGATGAGGAAACAGACCCAGAGG - Intergenic
904634534 1:31869682-31869704 TGATGAGCAGAGTCTGCCACAGG + Intergenic
906118488 1:43371416-43371438 AGATGATGAAACTGTCCCAGAGG + Intergenic
907275524 1:53314729-53314751 TGCTGAGGAAACTCCTGCACTGG + Intronic
908347940 1:63254747-63254769 AAATGAGAAAACACTCCCACTGG + Intergenic
910548607 1:88450052-88450074 TAATGAGGTACCTCTTCCACTGG - Intergenic
911155175 1:94629457-94629479 TGATGATGACACTCTTTCACTGG - Intergenic
912578673 1:110700450-110700472 TGACAAGGAAACTCTCCATCAGG + Intergenic
914219172 1:145662699-145662721 AGGTGAGCAAACTCTGCCACTGG - Intronic
914471755 1:147985570-147985592 AGGTGAGCAAACTCTGCCACTGG - Intronic
916251393 1:162742000-162742022 GGATGAGGAAACACTAACACAGG - Intronic
916567314 1:165992281-165992303 AGATGAGGAAACTGAGCCACAGG - Intergenic
918685555 1:187410272-187410294 AGATAAGGAAACTTTCCCAGGGG + Intergenic
921552314 1:216553037-216553059 TGCTGAGGACACCCTGCCACTGG + Intronic
923299489 1:232629114-232629136 TGATGACAAATATCTCCCACAGG + Intergenic
1064019818 10:11799960-11799982 TGATCAGGAAACCGTGCCACTGG - Intergenic
1065129328 10:22604729-22604751 TGCTGAGTAGAGTCTCCCACCGG - Intronic
1065492268 10:26293891-26293913 TGATGGAGAAACTGACCCACAGG + Intronic
1067185389 10:44022761-44022783 TGAACAGAAAACTCTCCCAGTGG - Intergenic
1068277705 10:54824093-54824115 TCCTGTGGAAACTCTTCCACTGG - Intronic
1070406610 10:76103367-76103389 TGATGAGGAAACTCTCCCACTGG - Intronic
1070419072 10:76218506-76218528 TGAGGTTGAAACTCTCCCCCAGG + Intronic
1073117523 10:101100107-101100129 TGGGGAGGAAACTGTCTCACAGG + Intronic
1077965040 11:7120938-7120960 TGATGCTGAAACTCTCCCAGTGG - Intergenic
1082701074 11:56431574-56431596 TGATGATGAAACTGTCTCTCTGG - Intergenic
1083253260 11:61481811-61481833 TGATGGGGAAACTCCCCCTGGGG + Exonic
1084094013 11:66898257-66898279 TAATGAGGAAACTTTCCCACCGG - Intronic
1084549232 11:69830987-69831009 TGGTGAGGAAACTCCCCTCCTGG - Intergenic
1085795071 11:79531806-79531828 TGAAGTGGAAATACTCCCACTGG + Intergenic
1087508136 11:99054701-99054723 TGATGAGGTAAGTCTTCCATTGG - Intronic
1088699805 11:112401527-112401549 TGATGAGGAAATTGTCCCGCTGG - Intergenic
1090393727 11:126405942-126405964 GGATGAGAAAACTCACCCTCAGG + Exonic
1092433530 12:8427895-8427917 TGATGAGGAAACCCTCAGAATGG + Intergenic
1093473438 12:19529312-19529334 TGATGGGGAAACTAGCCCAAAGG + Intronic
1093559878 12:20525193-20525215 AGATGAGGAAACTGACGCACAGG - Intronic
1093942583 12:25070653-25070675 TGATGCAGTAACTCTGCCACAGG - Intronic
1095414886 12:41965631-41965653 TGATAAGGAAACTTGCCCTCAGG - Intergenic
1095856913 12:46870388-46870410 TGAAGAAGAAATCCTCCCACAGG - Intergenic
1101410065 12:104460069-104460091 TGATGTGGAATCTCTTTCACTGG + Intronic
1101850941 12:108401802-108401824 AGATGAGGAAACTGTCCCCTGGG + Intergenic
1103191215 12:119003630-119003652 TCATAAGGAAACCCTCCCAATGG + Intronic
1105766881 13:23568481-23568503 TGGTGAATAAACTCTTCCACTGG + Intergenic
1106441099 13:29771535-29771557 TGATGAGGAAACTGGAACACAGG + Intronic
1106906986 13:34419693-34419715 GGATGAGGAAAGCCTCCCAGGGG + Intergenic
1110317618 13:74129492-74129514 TGGTGGGGAAACTATCCCAAAGG + Intronic
1112559831 13:100503054-100503076 AGTGGAGGATACTCTCCCACTGG + Intronic
1114277130 14:21156804-21156826 TGATGAGGAGACTCTCCCGTTGG - Intergenic
1115423300 14:33222972-33222994 TGATGGGGGAACCCTACCACAGG - Intronic
1117497754 14:56322644-56322666 TGATGATGAAACTCACTGACTGG - Intergenic
1118016303 14:61664549-61664571 TGATGACAAAACTCCCCCTCAGG + Intergenic
1121693555 14:95894706-95894728 GGAAGAGCAAGCTCTCCCACAGG + Intergenic
1125495205 15:40186774-40186796 TTATGAGGTAACTCTTGCACTGG - Intronic
1126102519 15:45128535-45128557 TGAAGAGGAAAGTCTAGCACAGG - Intronic
1131011632 15:89022707-89022729 TGAGGAGGACGCTTTCCCACGGG - Intergenic
1133907154 16:10032871-10032893 TGATAAGGAAACTCTCCATTGGG - Intronic
1137576612 16:49604254-49604276 TGGTGAGGGCACTCTCTCACAGG - Intronic
1137945441 16:52729703-52729725 TGATGGGGAAAGGCTCCCAAAGG + Intergenic
1138416605 16:56875202-56875224 TGCTGAGGATGCTGTCCCACAGG - Intronic
1140854080 16:78962133-78962155 TGAACAGGAATCTCTCCCAGAGG + Intronic
1141770364 16:86086039-86086061 AGATGAGGACACACTCCCAGGGG + Intergenic
1143629173 17:8127526-8127548 TGCTGATGAAAATCCCCCACTGG - Intergenic
1146762573 17:35491196-35491218 TGATTTGGAAAAGCTCCCACTGG + Intronic
1150657820 17:67051817-67051839 TGCTGAGGTGACTCTCACACAGG - Intronic
1152309077 17:79538209-79538231 TGATGAGTCTTCTCTCCCACAGG + Intergenic
1152964253 18:99870-99892 TGAGGAGGGAACTCTGCCATGGG - Intergenic
1155521782 18:26675575-26675597 TGATGAGGAAACTGAGGCACAGG - Intergenic
1155564614 18:27120316-27120338 TTATGAGGAAACTCTGCTACTGG - Intronic
1155688094 18:28580504-28580526 TCATGAGGAAAATCTCCCTGAGG - Intergenic
1156315680 18:35966815-35966837 TGATGAGGAAACGCAGCCATGGG + Intergenic
1156715888 18:40010202-40010224 TTATGAGGAAACTCTACCCTGGG + Intergenic
1157216430 18:45787303-45787325 AGATGAAGAAAATCTCCCTCAGG + Intergenic
1157728444 18:49983458-49983480 TGATGAAGAAACTTGCCCAGAGG - Intronic
1160078078 18:75696590-75696612 TGATGAGGAAGCTCCCACAGTGG + Intergenic
1165460796 19:35943176-35943198 TGATAAGTCAACTCTCCAACAGG + Intronic
1166800947 19:45456510-45456532 AGATGAGGAAACTGTCCCTTAGG - Intronic
1168453303 19:56483133-56483155 TAAGAAGGATACTCTCCCACTGG - Intergenic
1168476184 19:56677094-56677116 TGGTGAGGCAAGTCTCCCATGGG + Intergenic
926040308 2:9667475-9667497 TGTGGAGGAGTCTCTCCCACAGG + Intergenic
927370582 2:22350482-22350504 TGATTAGAAAACATTCCCACAGG - Intergenic
928119578 2:28573802-28573824 TGGTTAGGAACCTCTCCCACAGG + Intronic
928782724 2:34844661-34844683 TGATGAGAAAAATCTCCTAATGG - Intergenic
929522610 2:42668019-42668041 TGATGAGGAAACTCAGACAAAGG - Intronic
933644372 2:84798707-84798729 TGCTGTGGGCACTCTCCCACAGG - Intronic
933715957 2:85360805-85360827 TGATCAGGAAATTCTTTCACTGG + Intronic
933771789 2:85749268-85749290 CCATGAGGAAACTCTCCTAGTGG - Intergenic
936010140 2:108920287-108920309 AGATGAGGACACTTTCCCAGGGG + Intronic
936050298 2:109217652-109217674 AGATGAGGAAGCTCTCTCACCGG + Intronic
945958728 2:216109856-216109878 TGATAAAGCAACTATCCCACAGG + Intronic
948424912 2:237881043-237881065 TGATGAGGTAAGTTGCCCACAGG - Intronic
1169060675 20:2658522-2658544 TGATGATGATTCTCCCCCACAGG - Exonic
1173959250 20:47058417-47058439 TCCTGAGGAAACTCACACACAGG + Intronic
1174190662 20:48738250-48738272 TGATTAGGAATGTCTGCCACAGG + Intronic
1179658195 21:42858641-42858663 ATATGAGGAAAATCTTCCACGGG - Intronic
1180850418 22:19016524-19016546 TGATCAGAAAACTCTCCCTTAGG + Intergenic
1182196460 22:28523624-28523646 TGATGATGCATCTCTCTCACTGG - Intronic
1182865428 22:33600143-33600165 TGATAAAGAAACTCTGCCATCGG + Intronic
1184258815 22:43302842-43302864 GAAGGAGGAAACGCTCCCACGGG + Intronic
952888725 3:38027428-38027450 AGATGAGGAAACTGACACACAGG + Intronic
955226122 3:57061992-57062014 AGATGTGGAAACCCTCCCAAAGG - Intronic
956187710 3:66578476-66578498 TGATGAGGAAACTGAGGCACAGG + Intergenic
958706223 3:97659427-97659449 AGATGATGAAAATGTCCCACAGG + Intronic
959567005 3:107842668-107842690 TCATGAGGGATCTGTCCCACTGG - Intergenic
960325692 3:116292925-116292947 TCAAGAGGTAACCCTCCCACAGG - Intronic
961753780 3:129114450-129114472 AGATGGGGATAGTCTCCCACAGG + Intronic
962669568 3:137691324-137691346 TCATGATGAAACTTCCCCACAGG - Intergenic
965083282 3:164063616-164063638 TGATTAAGTTACTCTCCCACTGG - Intergenic
965483686 3:169251611-169251633 TGATGTGGCTCCTCTCCCACTGG - Intronic
968420681 4:482099-482121 TGTTGATGAAATGCTCCCACAGG + Intronic
971651429 4:29280367-29280389 TGAAATGGAAACTTTCCCACTGG + Intergenic
975789890 4:77937619-77937641 TGAGGAGGAAAGTCTCCAAGAGG - Intronic
979954841 4:126939973-126939995 GGATGAGGAAAGTCTGGCACAGG + Intergenic
980966162 4:139523119-139523141 GGGTGAGGAAACTCTCTTACAGG + Intronic
992166434 5:74056405-74056427 TTTTAAGGAAACTCTCCCTCTGG + Intergenic
992328722 5:75692426-75692448 TGATGAGAACATTCTTCCACTGG - Exonic
995401797 5:111750481-111750503 TGATTAGCAATGTCTCCCACAGG + Intronic
998731302 5:145080607-145080629 AGATGAGGAAACTGACCCACAGG + Intergenic
1011927498 6:92665194-92665216 TGATGAAAAAAGTCTCCTACAGG + Intergenic
1012793627 6:103733759-103733781 TGCTGAGCACACACTCCCACTGG + Intergenic
1022420119 7:30212210-30212232 TGATTAGGGTCCTCTCCCACAGG + Intergenic
1024994993 7:55267221-55267243 TGAGGAGGAAGCTCTTCCACTGG - Intergenic
1026949696 7:74338884-74338906 TGTTGAGGACGCTCTCCCGCAGG - Exonic
1027608976 7:80335602-80335624 TGAGGAGCAAACTGTCACACAGG - Intergenic
1034456947 7:151175766-151175788 TGATGAAGACACACTCCTACTGG - Exonic
1036980663 8:13466523-13466545 TGACCAGGTATCTCTCCCACAGG - Intronic
1038032787 8:23659208-23659230 TGTGGAGGAGACTCTCTCACTGG - Intergenic
1038879580 8:31593211-31593233 TAATGAGGAAGCTTTCCTACTGG + Intergenic
1038944767 8:32346609-32346631 TGGTGAGGAAAATATCCAACAGG - Intronic
1047330859 8:123885609-123885631 AGATGAGGAAACTGAGCCACAGG + Intronic
1048432794 8:134385678-134385700 GGAAGAGGAAACTCTCCCTTGGG - Intergenic
1048892299 8:138959026-138959048 AGATGAGGAAACTGAACCACGGG + Intergenic
1051485030 9:17598822-17598844 TGATGAGGAAACTAAGGCACAGG + Intronic
1053285106 9:36845144-36845166 TCAGAAGGAACCTCTCCCACAGG + Intronic
1055856846 9:80698523-80698545 TGATGAGGAAACTAGGGCACAGG + Intergenic
1056897395 9:90563752-90563774 TTATGATGCAACTCGCCCACAGG + Intergenic
1058201202 9:102043114-102043136 TGATGAGGAATCCCGCACACAGG - Intergenic
1058544716 9:106048807-106048829 GGAGGAGAAATCTCTCCCACTGG - Intergenic
1062432991 9:136534247-136534269 TGCTGAACAAACTCTTCCACAGG - Intronic
1186776728 X:12872287-12872309 TCATTAGGCAGCTCTCCCACAGG + Intronic
1189379512 X:40491844-40491866 TGATGAGGAAACTGAGGCACAGG - Intergenic
1189446834 X:41087307-41087329 TGATTAGGAAACTTTCCAGCAGG + Intronic
1190999962 X:55649364-55649386 AAATGGGGAAACTGTCCCACAGG + Intergenic
1191590864 X:62883003-62883025 TCATGAGGATATTCTCCAACAGG + Intergenic
1195599046 X:106725743-106725765 TGATGAGGAAACTGAGCCACAGG + Intronic
1195933705 X:110105376-110105398 AGATGAGGGAACTCCCTCACAGG + Intronic
1198600006 X:138272286-138272308 TCATGAGTAAAATCTCCCAGCGG - Intergenic