ID: 1070410147

View in Genome Browser
Species Human (GRCh38)
Location 10:76132219-76132241
Sequence CAAAATCACCACCTCTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070410147_1070410152 2 Left 1070410147 10:76132219-76132241 CCAAAATAGAGGTGGTGATTTTG 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1070410152 10:76132244-76132266 GCCCAAGAAGCAGGAAGGCAGGG No data
1070410147_1070410149 -7 Left 1070410147 10:76132219-76132241 CCAAAATAGAGGTGGTGATTTTG 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1070410149 10:76132235-76132257 GATTTTGGAGCCCAAGAAGCAGG No data
1070410147_1070410151 1 Left 1070410147 10:76132219-76132241 CCAAAATAGAGGTGGTGATTTTG 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1070410151 10:76132243-76132265 AGCCCAAGAAGCAGGAAGGCAGG No data
1070410147_1070410150 -3 Left 1070410147 10:76132219-76132241 CCAAAATAGAGGTGGTGATTTTG 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1070410150 10:76132239-76132261 TTGGAGCCCAAGAAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070410147 Original CRISPR CAAAATCACCACCTCTATTT TGG (reversed) Intronic
909960492 1:81834937-81834959 CACAATCAAGACCTCTATTGTGG - Intronic
911473691 1:98349958-98349980 CAAAAGCAGCACCTCTTTCTTGG + Intergenic
912779071 1:112527050-112527072 CAAAATCTGGACCTCTGTTTAGG + Intronic
914800385 1:150957338-150957360 AAAAAACACCACCTGTATTAGGG + Intronic
916844120 1:168630897-168630919 CTCAATCACCTCCTCTATCTTGG - Intergenic
918036121 1:180873819-180873841 CAGAATCACATCCTCTATTATGG - Exonic
918139614 1:181709427-181709449 CAAGGACACCAGCTCTATTTTGG + Intronic
920161654 1:204003129-204003151 AAATATTACCACCTCTACTTTGG - Intergenic
922026775 1:221757087-221757109 CACAAACACCACCACCATTTTGG + Intergenic
923497050 1:234534869-234534891 AAAAATCTCCAATTCTATTTGGG + Intergenic
1063694000 10:8315262-8315284 CTAAATCTCCACTTCAATTTGGG - Intergenic
1063992410 10:11580296-11580318 CAAAATCATGATCTCCATTTTGG + Intronic
1064014321 10:11760990-11761012 CTAAATCACCACCTCTGTTTTGG - Intronic
1065006299 10:21383468-21383490 CAAAATCACCAAATGTAATTAGG + Intergenic
1067163406 10:43845771-43845793 CAAAATGCCCACTTCTGTTTTGG - Intergenic
1067540162 10:47145076-47145098 AAAGATCACCACTTCTATTAGGG - Intergenic
1068070982 10:52195290-52195312 CAAAAGCAACACCTTCATTTTGG - Intronic
1070410147 10:76132219-76132241 CAAAATCACCACCTCTATTTTGG - Intronic
1070450303 10:76551215-76551237 TAAAAACACCACCACGATTTAGG + Intronic
1070958712 10:80483582-80483604 CAAAATTGCCACCACTATTGTGG - Intronic
1072861484 10:99009769-99009791 AAAAATGAGCAACTCTATTTTGG - Intronic
1073901349 10:108224903-108224925 CAAACTCTCCTTCTCTATTTGGG - Intergenic
1074749565 10:116571613-116571635 CAACATCATCAACTCTACTTAGG - Intergenic
1075549765 10:123383530-123383552 CAAAATCCACACCTTAATTTTGG + Intergenic
1076597693 10:131635973-131635995 CACAATCACCACTTCTGTTCAGG - Intergenic
1079468911 11:20759703-20759725 CTAAATCACCACCTCTGTCCAGG + Intronic
1079544423 11:21615263-21615285 AAAAATTACCACGTCTATCTGGG + Intergenic
1082907417 11:58324976-58324998 TAATATCACCACTTTTATTTTGG + Intergenic
1086587634 11:88473973-88473995 CAAAATCTATACCTCTACTTGGG + Intergenic
1087643774 11:100784074-100784096 TCAAATAACCTCCTCTATTTAGG - Intronic
1088530864 11:110807847-110807869 CAAATACAGGACCTCTATTTAGG - Intergenic
1088931078 11:114351318-114351340 CAAACACACCAACGCTATTTGGG + Intergenic
1089096328 11:115922935-115922957 CAAAACCAGCTCCTCTAATTTGG + Intergenic
1091274097 11:134338443-134338465 CAAGGTCACCACCTCTTTCTGGG - Intronic
1095257674 12:40059099-40059121 GAAAATCACTACCTCTATTCTGG - Intronic
1097595883 12:61630203-61630225 AATAATCACCACCTCTTATTGGG + Intergenic
1099000378 12:77171911-77171933 CAAAAGCAGCAGCTCTGTTTAGG - Intergenic
1099083518 12:78216450-78216472 CATATCCACCACCCCTATTTTGG + Intergenic
1099097970 12:78399580-78399602 CATAATCTCCATCTTTATTTGGG + Intergenic
1099746112 12:86707192-86707214 CAAAGTCACTACCACAATTTTGG - Intronic
1100824890 12:98465342-98465364 GAAAATCAACACCTTGATTTTGG - Intergenic
1102144152 12:110641994-110642016 CAAAATCACTACATCTGTTTAGG - Intronic
1102248029 12:111367555-111367577 CAAGATCAGCCCCTTTATTTGGG - Intronic
1104158407 12:126154998-126155020 CAATTTCAAAACCTCTATTTTGG - Intergenic
1106573325 13:30950580-30950602 CAAAATGTTCACCTCTTTTTAGG - Intronic
1106596205 13:31141194-31141216 AACATTCACCACCTTTATTTTGG + Exonic
1106973101 13:35168602-35168624 CAAAATCCCTACCTCAATTCTGG - Intronic
1108090106 13:46840622-46840644 CAAAATCAAGACCTCTACTCAGG + Intronic
1110336068 13:74331682-74331704 CAAAACCAACACCTCTCTTAAGG - Intergenic
1111346453 13:86961610-86961632 TAAAATGACCACCAATATTTGGG - Intergenic
1115396253 14:32911717-32911739 CAAAATCATCACCTAAACTTGGG - Intergenic
1116515650 14:45801946-45801968 CAAAATAACCACATCAATATAGG - Intergenic
1117319759 14:54609872-54609894 TAAAATCACCATCTCTTTGTGGG + Intronic
1120306448 14:82777018-82777040 CCAAATCACCAGGTCTTTTTTGG + Intergenic
1121872174 14:97418568-97418590 CAAATTCCCCTCCTCCATTTAGG + Intergenic
1202847163 14_GL000009v2_random:189139-189161 TAAAATCAGTAGCTCTATTTAGG - Intergenic
1202916626 14_GL000194v1_random:179701-179723 TAAAATCAGTAGCTCTATTTAGG - Intergenic
1202876149 14_KI270722v1_random:3360-3382 TAAAATCAGTAGCTCTATTTAGG + Intergenic
1123693030 15:22855068-22855090 AAAAATCACCATGCCTATTTTGG + Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1126225195 15:46262009-46262031 CAGACTCACCACCTCTCCTTGGG + Intergenic
1126338087 15:47608599-47608621 TCAAATCACCTCCTATATTTGGG + Intronic
1126985558 15:54303204-54303226 CAAAATCACAGACTCTATTATGG - Intronic
1129383626 15:75183614-75183636 CAAAAACACAACCTATGTTTTGG - Intergenic
1130331830 15:82928252-82928274 CAGAATCAACAGCTTTATTTAGG - Intronic
1130484310 15:84390061-84390083 AAAAAATACCACCTCTATTATGG - Intergenic
1130858605 15:87864981-87865003 GAAAAGCAACACCTCTGTTTCGG - Intronic
1131080174 15:89527800-89527822 CCAAACCACCACCTTTAGTTTGG + Intergenic
1131288354 15:91081708-91081730 AAAAATCAACAACTCTTTTTAGG - Intergenic
1134903888 16:17962827-17962849 AAAGATCACCACCTCTTGTTTGG + Intergenic
1138294656 16:55875939-55875961 CAACACCACCACCCCCATTTTGG + Intronic
1140865500 16:79057563-79057585 CAAAATCACCAACTCTCTGAAGG - Intronic
1143028519 17:3954480-3954502 AAAAATCAGCACCTCAATTGAGG - Intronic
1144155074 17:12492234-12492256 CAACACCAACACCTCTGTTTTGG + Intergenic
1147451954 17:40511278-40511300 TGCAACCACCACCTCTATTTCGG + Intergenic
1148905560 17:50909743-50909765 GAAAATCACAAGCTCTCTTTGGG - Intergenic
1148985137 17:51614042-51614064 AGAAAATACCACCTCTATTTTGG + Intergenic
1149194924 17:54108164-54108186 CAAAACCACCACCTCCGTGTTGG - Intergenic
1149281964 17:55115537-55115559 CAAAATCTGCACTTCTATTTGGG - Intronic
1158020356 18:52834213-52834235 CAAACTCTCCAGCTCTTTTTAGG + Intronic
1158048003 18:53180034-53180056 CAAAATCACCTCTTGTATTTTGG + Intronic
1159347080 18:67220098-67220120 CAAAATCAACACCTTGATTTAGG + Intergenic
1162861841 19:13511671-13511693 CAAACTCACCATCTCTTTCTTGG + Intronic
1162964767 19:14150643-14150665 CACACGCACCAGCTCTATTTGGG - Exonic
1164052318 19:21593892-21593914 GAAAGTCAACACCTGTATTTTGG - Intergenic
1202674511 1_KI270710v1_random:29453-29475 TAAAATCAGTAGCTCTATTTAGG - Intergenic
930239128 2:48917746-48917768 AAAAAACACCACTTCTAGTTAGG - Intergenic
932879008 2:75482627-75482649 CACAATCACCAGCTCCCTTTAGG - Intronic
933303150 2:80565570-80565592 CAAAATCACCTAGTCTCTTTTGG - Intronic
936816996 2:116472103-116472125 AAAAATGACCAAGTCTATTTGGG - Intergenic
937443885 2:121940273-121940295 CAAAATCAATGCCTCTATCTAGG - Intergenic
939175183 2:138739970-138739992 CAAAATTACCACAGCTATTATGG - Intronic
941417257 2:165236327-165236349 TAAAATCCACACCTTTATTTTGG - Intergenic
942798507 2:179849419-179849441 CAAAGGCAACACATCTATTTGGG + Intronic
947308064 2:228769094-228769116 CAAACTCACCACCTCTAAGTTGG - Intergenic
947338245 2:229109590-229109612 CAAAATCACCACTGCTACTAAGG + Intronic
947973842 2:234346970-234346992 CAAGGTCACTACTTCTATTTTGG - Intergenic
1176635981 21:9194348-9194370 TAAAATCAGTAGCTCTATTTAGG - Intergenic
1176637427 21:9260733-9260755 AAAAATCAGTAGCTCTATTTAGG + Intergenic
1177191488 21:17856753-17856775 CAAAACCACCATCTGTATTTGGG + Intergenic
1178163045 21:29940386-29940408 GAAAATCACCTCCAATATTTTGG + Intergenic
1180421464 22:12868230-12868252 AAAAATCAGTAGCTCTATTTAGG + Intergenic
1182729661 22:32477067-32477089 CAAAAACACCACCCCAACTTTGG - Intronic
1183013143 22:34963685-34963707 CACAACCACTACCTCTATCTAGG - Intergenic
949744311 3:7270783-7270805 CAAAGTAACCACTTCGATTTTGG + Intronic
951337747 3:21444898-21444920 CCTGATCACCACCTCTTTTTGGG - Intronic
955160211 3:56458004-56458026 CAAAATTACCTGCTCTATTATGG + Intronic
955309484 3:57870823-57870845 CAAAATGACCAAATCTATTTTGG - Intronic
957103461 3:75856306-75856328 TAAAATCAGTAGCTCTATTTAGG - Intergenic
958538742 3:95439926-95439948 CAAAATTACAGCCTATATTTTGG - Intergenic
959881409 3:111448340-111448362 CAAGATCACCCTCTCTATTCAGG - Intronic
960243449 3:115372952-115372974 CAAAATAACTACCTCCATGTGGG + Intergenic
960505217 3:118485703-118485725 CAAAATGACCACATTTATTTTGG + Intergenic
963599028 3:147361205-147361227 CAGAATCTCAACCCCTATTTTGG - Intergenic
965447728 3:168796464-168796486 CAAAATCAGCATTTCTGTTTTGG - Intergenic
1202749468 3_GL000221v1_random:144287-144309 AAAAATCAGTAGCTCTATTTAGG - Intergenic
970129528 4:12851891-12851913 CAAAATCCCATCTTCTATTTTGG + Intergenic
970518110 4:16854392-16854414 CAAAATAACCACTGTTATTTTGG - Intronic
970518115 4:16854431-16854453 CAAAATAACCACTGTTATTTTGG - Intronic
971334190 4:25707522-25707544 TACAATCACCACCTTTATCTAGG + Intergenic
972475829 4:39448183-39448205 AAAAATCACTACCTTTATTATGG + Intronic
973821822 4:54668407-54668429 CAAAATATCCACCTTCATTTGGG + Intronic
974531944 4:63119745-63119767 AAAAATCACCTTTTCTATTTTGG + Intergenic
975789967 4:77938564-77938586 ACAAACCACCACCACTATTTGGG - Intronic
977410524 4:96655920-96655942 CAAATTAACCACCTCTATAATGG + Intergenic
980804668 4:137796305-137796327 GAAAATCTCAACCTCCATTTAGG - Intergenic
981569819 4:146139559-146139581 CAAAATCACCACTCTTATTTTGG + Intergenic
981921453 4:150089168-150089190 AAACATCATCACCTCTTTTTTGG + Intronic
982946580 4:161631846-161631868 CTTAATTACCAACTCTATTTAGG - Intronic
985008905 4:185562365-185562387 CAAAAGCACCACCTCTAGAGTGG + Intergenic
1202752320 4_GL000008v2_random:19149-19171 TAAAATCAGTAGCTCTATTTAGG + Intergenic
986407969 5:7445567-7445589 CAAAGTCACCACTTCTCTTTAGG - Intronic
987023038 5:13894895-13894917 CAAAATGACTACTTTTATTTAGG + Intronic
987206331 5:15630374-15630396 AAAAATCACAAGCTCTAATTTGG - Intronic
994012708 5:94925250-94925272 TACAATCACCACTTCTGTTTAGG - Intronic
994776665 5:104043074-104043096 CAAAATCAACAACTCTTCTTAGG + Intergenic
995082604 5:108071360-108071382 AAAAATCAAGAGCTCTATTTGGG + Intronic
995877062 5:116801444-116801466 AAAAATCAAGAGCTCTATTTTGG + Intergenic
995931010 5:117444150-117444172 CAAAATAACAACATATATTTTGG - Intergenic
996588197 5:125115352-125115374 CAAAATGACAACCACTCTTTTGG + Intergenic
998600841 5:143583362-143583384 CAAGATCACCACCCCTTTTCTGG - Intergenic
998891769 5:146753817-146753839 CAAAACCACTTCCTCTATTATGG - Intronic
998965243 5:147532548-147532570 CAAATTCAACAATTCTATTTAGG - Intergenic
1002957477 6:1880849-1880871 TAATATCTCCACCTGTATTTAGG + Intronic
1008354692 6:50538418-50538440 CAAAACCTCCACTTCTGTTTAGG - Intergenic
1010226681 6:73496254-73496276 CAGAATAAGCACCTCAATTTAGG + Intronic
1017702322 6:157087149-157087171 CAAAAGCTCCACCTTTTTTTTGG + Intronic
1018003550 6:159600296-159600318 GCAAATCAACAGCTCTATTTGGG + Intergenic
1022224639 7:28350312-28350334 CAATAACACCACCTCTACTGAGG - Intronic
1026172089 7:67962928-67962950 TAAAATCTCTATCTCTATTTGGG - Intergenic
1027782697 7:82538934-82538956 CCTAATCACCACCTCTTATTAGG + Intergenic
1027999374 7:85471848-85471870 CTTAAACACCAACTCTATTTTGG + Intergenic
1036686685 8:10916317-10916339 CAAAATCACCACCCCTTTCTGGG + Intronic
1037706095 8:21316442-21316464 AAAAATCACCACCACTGTTCAGG + Intergenic
1038302289 8:26363764-26363786 CGAAATCATCTCCTCTATTTCGG + Exonic
1038438669 8:27556571-27556593 GAAAATGAACACCACTATTTGGG - Intergenic
1043642287 8:82470167-82470189 CAGAATTACCAACTCTATTTTGG + Intergenic
1046997445 8:120540144-120540166 CAAACTCACCAACTCTGTTGGGG - Intronic
1048066613 8:130976023-130976045 AAAAACCACCACCTATCTTTTGG + Intronic
1048621458 8:136137398-136137420 CATAATACCCTCCTCTATTTTGG + Intergenic
1052272264 9:26639139-26639161 CAAAATCACTACTGCTATGTTGG - Intergenic
1052414764 9:28164179-28164201 CAAAATAATCACCTCTAGTTAGG - Intronic
1052794888 9:32914220-32914242 CAAAATCAGGACTTCTGTTTTGG + Intergenic
1053398324 9:37795842-37795864 CAAAATTACCTGCACTATTTAGG - Intronic
1057583024 9:96304516-96304538 CAAAACCACCTCCTCTATGGAGG - Intergenic
1058675515 9:107396745-107396767 CACAATCAGCACAGCTATTTAGG - Intergenic
1060379714 9:123156147-123156169 CAAATTCACAACCACTCTTTCGG - Intronic
1061794985 9:133081272-133081294 CAGAATTACCTCCTTTATTTAGG + Intronic
1203718109 Un_KI270742v1:174378-174400 AAAAATCAGTAGCTCTATTTAGG - Intergenic
1203533111 Un_KI270743v1:3850-3872 TAAAATCAGTAGCTCTATTTAGG + Intergenic
1203652334 Un_KI270751v1:137927-137949 TAAAATCAGTAGCTCTATTTAGG - Intergenic
1185535527 X:858519-858541 CAAAGTCTCCAACTCTGTTTGGG + Intergenic
1185753506 X:2633538-2633560 CAAAATCCCCAGATCTATCTAGG + Intergenic
1186245815 X:7615813-7615835 CAAATTCACAACCTAGATTTTGG + Intergenic
1187831591 X:23388156-23388178 CAAAATCAAAATCTGTATTTAGG + Intronic
1190630127 X:52378117-52378139 GAAAAGCATCCCCTCTATTTAGG - Intergenic
1190955438 X:55188446-55188468 GAAAATCACCTCCTCTGTTTTGG + Intronic
1191586228 X:62829497-62829519 GAAAATCAAGACTTCTATTTTGG + Intergenic
1192065711 X:67882692-67882714 CAAAATCACAATCTGGATTTTGG + Intergenic
1192787046 X:74345912-74345934 AAAAATTAGCACCTCTTTTTTGG - Intergenic
1194649017 X:96492789-96492811 CAAAATAACCAATTTTATTTTGG + Intergenic
1195106349 X:101605357-101605379 CATAATCACCACATTTGTTTTGG + Intergenic
1196634784 X:117989995-117990017 CAAAATCGCCTCCTATAATTGGG - Intronic
1196815486 X:119662347-119662369 CAAAATAATCAGCTCTGTTTTGG - Intronic
1201172267 Y:11279227-11279249 TAAAATCAGTAGCTCTATTTAGG - Intergenic