ID: 1070410380

View in Genome Browser
Species Human (GRCh38)
Location 10:76134021-76134043
Sequence TCTGTTCCTGGACTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 841
Summary {0: 1, 1: 0, 2: 10, 3: 276, 4: 554}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070410380_1070410384 26 Left 1070410380 10:76134021-76134043 CCCCAACAAAGTCCAGGAACAGA 0: 1
1: 0
2: 10
3: 276
4: 554
Right 1070410384 10:76134070-76134092 ATAATCTCAGAGAGCTTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070410380 Original CRISPR TCTGTTCCTGGACTTTGTTG GGG (reversed) Intronic
900039369 1:444757-444779 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
900060801 1:679733-679755 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
900350332 1:2231405-2231427 TGTCTTCCTGGGCTTTGCTGGGG + Intronic
902084020 1:13843380-13843402 TCTGGTCCCAGACTTTGTTTTGG + Intergenic
902944635 1:19825966-19825988 ACTGTACCTGGACTTTGTCCTGG + Intergenic
904828616 1:33292691-33292713 TCTGGTCCTGGACTTGGTTGTGG + Intronic
905437900 1:37971376-37971398 TCTGGTCCTGGACTTTTTTTTGG - Intronic
907979242 1:59464891-59464913 TCTGGTCCTGAACTTTTTTTTGG - Intronic
908457484 1:64318411-64318433 TCTGTTCCTGTCCTTTGCTTTGG - Intergenic
908560806 1:65304252-65304274 TCTGTTCTTGGTGTTTGATGGGG - Intronic
908611144 1:65862671-65862693 TCTGGTCCTGGACCTTTTTTTGG + Intronic
909053758 1:70798566-70798588 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
909211828 1:72833997-72834019 TCTGGTCCTGGGCTTTATTTTGG - Intergenic
909280148 1:73740831-73740853 TCTGTTCCTTGTTTTTATTGTGG - Intergenic
909682978 1:78313538-78313560 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
909698456 1:78492736-78492758 ATTGTTCATGGACATTGTTGTGG - Exonic
909767467 1:79374544-79374566 CCTGTTACAGGGCTTTGTTGTGG - Intergenic
910190706 1:84592387-84592409 TCTGGTCCTGGGCTTTTTTGGGG - Intergenic
910244121 1:85120598-85120620 TCTCTTACAGGACTTTGGTGAGG + Intronic
910306902 1:85774492-85774514 TTTGGTCCTGGACTTTGTTTTGG + Intronic
910336169 1:86133970-86133992 TCTGGTCCTGGACTTTTTTTTGG + Intronic
910460173 1:87440557-87440579 TCTGTTCCTTAAATTTGTTCAGG + Intergenic
910531451 1:88240939-88240961 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
910748376 1:90599370-90599392 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
911562307 1:99421108-99421130 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
911984864 1:104609876-104609898 TCTGGTCCTGGTCTTTTTTTTGG - Intergenic
912032277 1:105263740-105263762 TCTGGTCCTGGGCTTTGTTTTGG + Intergenic
912095519 1:106137399-106137421 TCTGTTTCTTGACATTGTTTTGG + Intergenic
912967057 1:114245324-114245346 TCTGATCCTGGGCTTTTTTTTGG - Intergenic
913616870 1:120569281-120569303 TCTGTTCTTTGAATTGGTTGGGG - Intergenic
913930996 1:124964461-124964483 TCTGGTCCTGGACTCTTTTTTGG + Intergenic
914317401 1:146526827-146526849 TCTGTTCCTTAAATTTGTTGAGG + Intergenic
914346359 1:146802516-146802538 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
914496955 1:148206533-148206555 TCTGTTCCTTAAATTTGTTGAGG - Intergenic
914573405 1:148941629-148941651 TCTGTTCTTTGAATTGGTTGGGG + Intronic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
916396623 1:164396676-164396698 TCTGGGCCTGGGCTTTGTTTTGG - Intergenic
916450474 1:164915790-164915812 TCTGTGCCTGGACTTTCTCGTGG + Intergenic
917158362 1:172028928-172028950 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
917843410 1:179001453-179001475 TCTGTGCCTGGACTGTGGTGTGG + Intergenic
917872990 1:179258378-179258400 ATTGTTCCTTGACTTTGATGGGG + Intergenic
918159593 1:181885730-181885752 CCTGGTCCTGGACTTTTTTTTGG - Intergenic
918938396 1:190955055-190955077 TCTGTTCCAGGCCTTTCTTTTGG + Intergenic
919136249 1:193511333-193511355 TCTGGTCCTGGGCTTTATTTTGG + Intergenic
919164792 1:193878400-193878422 TCTGTTCCTGGGCTTTTTTTTGG + Intergenic
919599311 1:199603035-199603057 TCTGGTCCCGGGCTTTGTTTTGG - Intergenic
919603472 1:199650835-199650857 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
919756058 1:201066819-201066841 TCTGTGCCAGGGCTTTGTAGTGG - Intronic
920985906 1:210888923-210888945 TCTGGTCCTGGGTTTTGTTTTGG - Intronic
921913779 1:220582543-220582565 ACTTTTCCTGGATTTAGTTGTGG + Intronic
921942814 1:220860734-220860756 TCTGGTCGTGGACTTTTTTTTGG + Intergenic
921962548 1:221050943-221050965 TCTGGTCCTGGTCTTTTTTTTGG - Intergenic
922415980 1:225423640-225423662 TCTGTGTCTGGAGTTTGCTGTGG - Intronic
922552030 1:226501882-226501904 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
923030918 1:230248512-230248534 CCTGTACCCGGACTTGGTTGTGG - Intronic
923422045 1:233825748-233825770 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
924764389 1:247018827-247018849 TCTGGTCCTGGGCTTTTTTTAGG - Intergenic
924885120 1:248206932-248206954 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1063265532 10:4445291-4445313 TCTGTTACTGTATTTTGTGGAGG + Intergenic
1064591387 10:16895209-16895231 TCAATTCCTTGACTTGGTTGAGG + Intronic
1064616501 10:17163887-17163909 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1064651191 10:17511586-17511608 TCTGTTTCTGGAAGTTGTAGGGG + Intergenic
1065075688 10:22076945-22076967 CCTGTTCCTGGATTTTTTTTTGG + Intergenic
1065077216 10:22092825-22092847 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1066297870 10:34070999-34071021 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1066639505 10:37541460-37541482 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1066751567 10:38662694-38662716 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1066799166 10:39165253-39165275 TCTGGTCCTGGACTCTTTTTCGG - Intergenic
1066965470 10:42260400-42260422 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1066988376 10:42488494-42488516 CCATTTCCTGGAGTTTGTTGTGG + Intergenic
1067350111 10:45467898-45467920 TCTGTTCCTGAAGTTCTTTGCGG + Intronic
1067409590 10:46052891-46052913 TCTGTTTCTGGATGATGTTGAGG + Intergenic
1067673703 10:48350137-48350159 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1067991448 10:51217664-51217686 TCTGTTTCTGGCCTTAGTTCTGG + Intronic
1068196919 10:53729206-53729228 TCTGGTCCTGGACTTTTTTCTGG - Intergenic
1068416585 10:56731840-56731862 TCTGTACCTGTACTTTGATCTGG - Intergenic
1068682525 10:59835703-59835725 TCTGTTTCTAGTCTTTGTTCAGG - Intronic
1068873492 10:61971427-61971449 TTTGTTCCTTGACTATGCTGAGG + Intronic
1069056955 10:63854313-63854335 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1069172980 10:65255691-65255713 TCTGATCCTGGACTTTTTTGGGG - Intergenic
1069263976 10:66435268-66435290 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1070003382 10:72398812-72398834 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1070054291 10:72920069-72920091 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1070080843 10:73185571-73185593 TCTGTGCCTGGACTTCTTTGTGG - Intronic
1070410380 10:76134021-76134043 TCTGTTCCTGGACTTTGTTGGGG - Intronic
1072870772 10:99117735-99117757 TTTGTTCCTGGGCTTTTTTGGGG - Intronic
1073022545 10:100457960-100457982 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
1074465147 10:113674922-113674944 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1074671961 10:115801111-115801133 TCTGTTCCTTTTCTTTGGTGAGG + Intronic
1074682868 10:115926780-115926802 TCTGGTCCTAGACTTTTTTTTGG - Intronic
1074795170 10:116935787-116935809 TCTGATCCTGGGCTTTTTTTTGG + Intronic
1074808803 10:117081657-117081679 TCTGGTCCTGGACTCTTTTTGGG + Intronic
1074902203 10:117827988-117828010 TCTGTTCCTGGACTGTGCCTTGG - Intergenic
1075479600 10:122768465-122768487 TATGTTCCTGGACTAAGCTGTGG - Intergenic
1075905937 10:126082276-126082298 TCAGTGCCTGGACTTGGCTGTGG - Intronic
1076158890 10:128226191-128226213 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1076538219 10:131196580-131196602 TCAGTGCCTGGACTTTCATGGGG + Intronic
1076965591 11:80669-80691 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
1077442654 11:2575827-2575849 GCAGTTCGCGGACTTTGTTGTGG - Intronic
1077702681 11:4456323-4456345 TCTGTTCCTTAAGTCTGTTGAGG - Intergenic
1077855384 11:6119095-6119117 TCTGCTCCTGGGCTTTCTTTTGG - Intergenic
1078691619 11:13586144-13586166 TCTGGTCCTGGGCTTTGTTTTGG - Intergenic
1078813757 11:14798553-14798575 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1078842177 11:15088314-15088336 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1079337544 11:19583999-19584021 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1080432905 11:32215015-32215037 CCTGTTCCTGGAATGTGTTCAGG - Intergenic
1081241123 11:40707832-40707854 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1081339850 11:41914695-41914717 TCTGATCCTGGGCTTTTTTTTGG + Intergenic
1081712320 11:45225227-45225249 TGTGTTCCTGGACTAAGTTAGGG - Intronic
1082147367 11:48686518-48686540 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1082196287 11:49310367-49310389 TCTGATCCTAGACTTTTTTTTGG + Intergenic
1083290408 11:61686781-61686803 GATGTTCCTGGACTTCCTTGAGG + Intronic
1083346582 11:61997628-61997650 TCTGTTCCTGCCCCTTGTTTAGG + Intergenic
1084389351 11:68865145-68865167 ACTGTTTCTGGACTCTTTTGCGG - Intergenic
1084766666 11:71313696-71313718 TCTTTTCCTATACTTTGTTATGG + Intergenic
1084840989 11:71847447-71847469 TCTGGTCCTGGACTTTTATTGGG + Intergenic
1085772009 11:79334136-79334158 TCTGTTGCTTGTTTTTGTTGGGG - Intronic
1086397180 11:86428330-86428352 TCTGTTCCTGGGCTTTTCTTTGG + Intergenic
1086456563 11:86964703-86964725 TCTGTTCCTGGACTTTTTTTTGG + Intergenic
1086565444 11:88220817-88220839 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1086659539 11:89397835-89397857 TCTGATCCTAGACTTTTTTTTGG - Intronic
1087383433 11:97438584-97438606 TCTGTTCCTGGGCATTTTTTTGG - Intergenic
1087569520 11:99906766-99906788 TCTGATCCTGGGCTTTTTTTTGG + Intronic
1087573821 11:99964781-99964803 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1087753822 11:102034040-102034062 TCTGGTCCTGGACCTTTTTTTGG + Intergenic
1088005146 11:104930595-104930617 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1088148660 11:106716551-106716573 TCTGTTCCTGGACCTGGGGGTGG - Intronic
1088309406 11:108444337-108444359 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1088650208 11:111951276-111951298 TCTGGGCCTGTACTTTTTTGAGG - Intronic
1089248600 11:117140814-117140836 TCTGGTCCTGGATTTTTTTTTGG - Intergenic
1089360545 11:117883263-117883285 GCTGTGCCTGGCCTTTCTTGGGG + Intergenic
1091140798 11:133233004-133233026 TGGGTACCTGGACTTTTTTGGGG + Intronic
1091824282 12:3498934-3498956 TCTGTTCCTTGCCTTTCTTCTGG + Intronic
1092304682 12:7287091-7287113 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1092569435 12:9706973-9706995 TCTGGTCCTGGGCTTTTCTGGGG + Intergenic
1093143324 12:15535680-15535702 TCTATTCCTGGACTGGGGTGTGG + Intronic
1093646869 12:21596124-21596146 TCTGGTCCTGAACTTTTTTTTGG - Intronic
1093677924 12:21965729-21965751 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1093792116 12:23264602-23264624 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1094225931 12:28046049-28046071 TCTGGTCTTGGACTTTTTTGTGG + Intergenic
1094875960 12:34643033-34643055 TCTGGTCCTGGCCTTTTTTTTGG - Intergenic
1095083599 12:38034931-38034953 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1095770499 12:45950153-45950175 TCTGAGCCTGGACCTTGGTGAGG + Intronic
1095793489 12:46192553-46192575 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1095939309 12:47715864-47715886 CCGATTCCTGGACTTTATTGCGG + Intronic
1096189290 12:49604925-49604947 TCTGATCCTAGAGTTTCTTGGGG - Intronic
1096891931 12:54780246-54780268 TCTGGTCCTGGACCTTTTTTTGG - Intergenic
1096950410 12:55462830-55462852 TCTGGTTCTGGACTTTTTTTTGG - Intergenic
1097139782 12:56891419-56891441 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1097352850 12:58567560-58567582 TGTGAGACTGGACTTTGTTGTGG - Intronic
1097537113 12:60886125-60886147 TCTGGCCCTGGACTTTTTTGGGG + Intergenic
1099196186 12:79618829-79618851 TCTTTGCCTGGAAATTGTTGTGG - Intronic
1099319844 12:81132249-81132271 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1099427977 12:82547797-82547819 TCTGGTCCTGCACTTTTTTTTGG + Intergenic
1100381659 12:94067775-94067797 TCTGATCCTGGACTTTTTTTTGG - Intergenic
1100652069 12:96601577-96601599 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1100896587 12:99189212-99189234 TTTGGTCCTGGACTTTTTTTTGG - Intronic
1101183995 12:102253761-102253783 TCTGGTCCTGGGCTTTTTTCTGG + Intergenic
1101218225 12:102606922-102606944 TCTGGTCCTGGGCTTTTTTCTGG + Intergenic
1101264380 12:103067877-103067899 TCTTTTCCTTGCCTCTGTTGTGG - Intergenic
1101487631 12:105181582-105181604 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1101600930 12:106209398-106209420 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1102045654 12:109828561-109828583 TCTGTTCCTGGGCTTTGCTGAGG - Intronic
1103153268 12:118660508-118660530 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1104131184 12:125895870-125895892 TCTTTTCCTGGACTTTGCTCAGG + Intergenic
1105430091 13:20328826-20328848 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1106349417 13:28913737-28913759 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1106426264 13:29633259-29633281 TCTGTTCCTGGGCTTTTTTTTGG + Intergenic
1106492920 13:30244919-30244941 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1106980517 13:35273884-35273906 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1107370651 13:39743624-39743646 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1108480009 13:50859434-50859456 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1108713251 13:53054862-53054884 TCTGTTCCTGGAACTTATTCAGG + Intergenic
1108976339 13:56447678-56447700 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1109216359 13:59594157-59594179 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1109509077 13:63345400-63345422 AATGTTCATGGACTTTGTAGGGG - Intergenic
1109972356 13:69786026-69786048 TCTGGTCCTGGACTCTTTTTGGG - Intronic
1110825035 13:79961952-79961974 TCTGATCCTGGACTTTTTTTTGG - Intergenic
1110912829 13:80984751-80984773 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1111341867 13:86897391-86897413 TCTGGTCCTGGCCTTTTTTTTGG - Intergenic
1111747091 13:92284259-92284281 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1112069123 13:95828688-95828710 TCTGGTCCTGGAGTTTTTTTTGG - Intronic
1112112488 13:96317875-96317897 TCTGTTCATGTCATTTGTTGGGG + Intronic
1112130781 13:96521472-96521494 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1112619192 13:101037121-101037143 TCTCTTTCTGGCCTTTGTTTGGG - Intergenic
1112663506 13:101541676-101541698 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1112854350 13:103747745-103747767 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1113406913 13:110049800-110049822 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1113920165 13:113903236-113903258 TCTGTTCCTCAACTGTGTAGAGG - Intergenic
1114741887 14:25105737-25105759 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1114797867 14:25737407-25737429 ACTGTGCCAGTACTTTGTTGAGG - Intergenic
1114989381 14:28268484-28268506 TCTGGTCCTGGCTTTTCTTGGGG - Intergenic
1115035200 14:28848739-28848761 TCTGGTCCTGGACTTTCTTTTGG - Intergenic
1115135319 14:30100948-30100970 TCTGGTCCTGGATTTTTTTTTGG - Intronic
1115265713 14:31498045-31498067 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1115719150 14:36140919-36140941 TCTGTGTCTCGACTTTTTTGAGG + Intergenic
1115974078 14:38977811-38977833 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1116035722 14:39625099-39625121 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1116198023 14:41754386-41754408 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1116208958 14:41908943-41908965 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1116398300 14:44473798-44473820 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1116717423 14:48445589-48445611 TCTGGTCCTGGACATTTTTTTGG - Intergenic
1117115411 14:52506093-52506115 TCTGGTCCTGGACTATTTTTTGG - Intronic
1117614881 14:57524093-57524115 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1117737865 14:58785968-58785990 TCTGTGACTTGACTTGGTTGAGG + Intergenic
1117857256 14:60048660-60048682 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1118415110 14:65527592-65527614 TCTGTTGCTGGCCTTTGGAGGGG + Intronic
1119679109 14:76578580-76578602 TCAGTTCTTGGACTTTGGTGGGG - Intergenic
1120449743 14:84652245-84652267 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1120736077 14:88054368-88054390 TCTGGTCCTGAACTTTTTTTTGG + Intergenic
1120807051 14:88763525-88763547 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1121470414 14:94149278-94149300 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1123576304 15:21673115-21673137 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1123612927 15:22115583-22115605 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1123872010 15:24585413-24585435 TCTGTTCCAGGATTGTGTTCAGG + Intergenic
1125224616 15:37381126-37381148 TCTGATCCTGGACATTTTTTGGG + Intergenic
1125391302 15:39195766-39195788 TTTGTTCCTGGACTATGGTCAGG - Intergenic
1126074199 15:44893151-44893173 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1126673886 15:51141072-51141094 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1126853887 15:52818658-52818680 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1126863021 15:52905555-52905577 TCTAGTCCTGGACTTTTTTTTGG - Intergenic
1127300314 15:57646644-57646666 GCTGCTCCTGTACTTTCTTGGGG - Intronic
1127326617 15:57901867-57901889 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1127355660 15:58196914-58196936 TCTGGTCCTGGAATTTTTTTTGG - Intronic
1127570924 15:60240679-60240701 TGTGGTCCTGGACTTTTTTTTGG - Intergenic
1127616654 15:60692819-60692841 TCTGGTCCTGGGCTTTCTTTTGG - Intronic
1128187881 15:65658965-65658987 TCTTTTCCCTGACTTTCTTGGGG - Intronic
1128610249 15:69067345-69067367 TCCCTTCCTGGTCTTTGGTGGGG - Intergenic
1128696899 15:69772575-69772597 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
1128895548 15:71369902-71369924 TCTGGTCCTGGAGTTTTTTTTGG + Intronic
1129564915 15:76611447-76611469 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1129971708 15:79783853-79783875 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1131278017 15:90998570-90998592 TCTTGGCCTGGACTTTGTAGTGG - Exonic
1131970545 15:97888263-97888285 TCTGTTGCTAGACATTGCTGCGG - Intergenic
1132442545 15:101882852-101882874 TCTGGTCCTGGACTGTTTTTTGG + Intergenic
1202985172 15_KI270727v1_random:407360-407382 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1132752937 16:1467168-1467190 TCTGCTCCTGGCTTTTGATGGGG - Intronic
1133427164 16:5702602-5702624 GTTGTTTTTGGACTTTGTTGAGG + Intergenic
1133510579 16:6453551-6453573 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1134767304 16:16771617-16771639 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1134792921 16:17006859-17006881 TCTGGTCCTGGACTTTTTTTGGG + Intergenic
1136450690 16:30352933-30352955 TTCTTTCCTGGACTTTGTGGAGG - Exonic
1136463894 16:30429082-30429104 TCTCCTCCTGGCCTTGGTTGGGG - Exonic
1136602906 16:31308270-31308292 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1136731160 16:32414410-32414432 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1136992856 16:35166928-35166950 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1137681951 16:50355856-50355878 TTGGTTCATGGATTTTGTTGAGG - Intronic
1137878206 16:52018056-52018078 TCTGATCCTGGACTTTTGTTTGG - Intronic
1137909322 16:52360510-52360532 TCTATTCCTGGCCCCTGTTGAGG - Intergenic
1138005589 16:53333136-53333158 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1138277064 16:55742857-55742879 CCTGTTCCTGGACTTAATGGGGG + Intergenic
1138282959 16:55786034-55786056 CCTGTTCCTGGACTTAATGGGGG + Intergenic
1139987620 16:70912752-70912774 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1140163797 16:72527917-72527939 TCTGGTCCTGGACTTTTTTCTGG + Intergenic
1140532943 16:75682796-75682818 TCTGATACTGGACTTGGTGGAGG + Intronic
1140582854 16:76251906-76251928 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1140695453 16:77528483-77528505 TTTGGTCCTGGACTTTTTTTTGG - Intergenic
1140883718 16:79223879-79223901 TCTGGTCCTGGACTTATTTTGGG - Intergenic
1141119682 16:81343148-81343170 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1141415249 16:83866364-83866386 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1202995232 16_KI270728v1_random:102860-102882 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1203021919 16_KI270728v1_random:415202-415224 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1143880838 17:10028599-10028621 TATCTTCCTGCCCTTTGTTGAGG - Intronic
1144208659 17:12996651-12996673 TCTGCTACTGGACTGTGGTGAGG - Exonic
1144431595 17:15197425-15197447 TCTGTTCAGGGACTTTTATGTGG - Intergenic
1145366685 17:22271371-22271393 CCTGACACTGGACTTTGTTGGGG - Intergenic
1146312588 17:31780557-31780579 TATGTCCCTGGTCTTTGGTGGGG - Intergenic
1147121824 17:38339579-38339601 TGTGTCCCTGGGCGTTGTTGGGG + Intronic
1147307990 17:39576842-39576864 TATATTCCTGGACTTTGTGGAGG - Intergenic
1147420817 17:40321407-40321429 CCTGTTCCTGGAATTTGGAGAGG + Intronic
1149063943 17:52458118-52458140 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1149247742 17:54731143-54731165 TCTGGTCCTGGGCTTTTTTCTGG - Intergenic
1149365776 17:55942474-55942496 TCTGGTCCGGGGCTTTTTTGTGG - Intergenic
1149613441 17:57976138-57976160 TCTGGTGCTGAATTTTGTTGAGG - Intronic
1150486565 17:65547911-65547933 TCTGTTTGTGTACTTTGTTGTGG - Intronic
1150895997 17:69211601-69211623 TCTGTTCCTGGACTCTTTGGGGG + Intronic
1150962100 17:69924873-69924895 TCTGGTCCTGGACTCTTTTTGGG - Intergenic
1152910304 17:83001310-83001332 CCTTTTCCTTGACTATGTTGTGG - Intronic
1153132125 18:1866076-1866098 TCTCTGCCTGGACTTTGCTCAGG - Intergenic
1153681089 18:7501641-7501663 TTTGTTTCTGGTCTTTTTTGAGG - Intergenic
1153717535 18:7865805-7865827 TCTGGTCCTGGAGTTTTTTTTGG + Intronic
1153761672 18:8337827-8337849 TCTGTGCCTGGACTGTGTCAGGG - Intronic
1153981014 18:10310586-10310608 TCTGTTCCTAGGATTTGGTGTGG - Intergenic
1155101926 18:22619734-22619756 TCTGGTCCTGGATTTTTTTTTGG - Intergenic
1155427295 18:25719971-25719993 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
1155681189 18:28488984-28489006 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1155773908 18:29734970-29734992 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1155907465 18:31469099-31469121 TCTGTTCCTGGGCTCTGAGGAGG - Exonic
1156296256 18:35794108-35794130 TCTGATCCTGGACTTTTTTTGGG - Intergenic
1156992630 18:43427878-43427900 TCTTTTTTTGCACTTTGTTGAGG - Intergenic
1157055750 18:44226489-44226511 TCTAATCCTGGGCTTTGTTTTGG + Intergenic
1157057946 18:44252864-44252886 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1157355067 18:46925705-46925727 TGTGGTCCTGGACTTTTTTTTGG + Intronic
1157397029 18:47350850-47350872 TCTGGTCCTGGACTCTTTTTTGG + Intergenic
1158337488 18:56429237-56429259 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1159557887 18:69963959-69963981 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1159630094 18:70739353-70739375 TCTGGTTCTGGACTTTTTTTTGG - Intergenic
1160092298 18:75838822-75838844 TGGGTTCCTGGACTCTCTTGTGG + Intergenic
1160642395 19:150299-150321 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
1160955935 19:1691732-1691754 TGTGTTCCTGGGCTGTTTTGGGG - Intergenic
1161218770 19:3108161-3108183 GCAGTTCCTGGGCTTTGTCGAGG + Intronic
1161567666 19:5012583-5012605 TTTGTGCCTGGACAGTGTTGAGG + Intronic
1162222982 19:9194548-9194570 TCTATTCCTGAACTTTGATTTGG + Intergenic
1162361802 19:10224854-10224876 AGTGTTCCTGGACCTTGTTGGGG + Exonic
1162702911 19:12531648-12531670 TTTGTTCCTGGCCTGGGTTGTGG - Intronic
1162723742 19:12677291-12677313 CCTGGTCCTGGACATCGTTGAGG - Exonic
1164085343 19:21896582-21896604 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1164416998 19:28054895-28054917 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1165003453 19:32784610-32784632 TCTGTTCCTGGAATTTTTTTTGG + Intronic
1165595997 19:37011661-37011683 GCTTTTCCTTGACGTTGTTGGGG + Intronic
1165822718 19:38686698-38686720 TCTCTTCCTGGACTCTGTGTGGG + Intronic
925169565 2:1742880-1742902 TCTGTCCCAGCACTTTGTTTCGG + Intronic
926970318 2:18460830-18460852 TCTGGTCCTGGAATTTTTTTTGG + Intergenic
927404845 2:22755165-22755187 TCTATTCCTTGACCTAGTTGTGG - Intergenic
927516662 2:23675496-23675518 TCTGTTCTTGGTTTTTGTTTGGG + Intronic
927567001 2:24122448-24122470 TCCGCTCCTGGATTTTGATGAGG + Exonic
927610461 2:24534064-24534086 TCTGGTCCTGGACTTTTTTTTGG + Intronic
928733994 2:34264516-34264538 TCTGGTCCTGGAATTTTTTGTGG - Intergenic
929926949 2:46221138-46221160 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
930019070 2:46990176-46990198 TCTCTTCCTGGAGCTCGTTGAGG + Intronic
930673387 2:54175151-54175173 TCTGGTCCTGGAGTTTTTTTTGG + Intronic
930911378 2:56633859-56633881 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
931755707 2:65372240-65372262 TCTGTTCCTGGACTGTGTGGAGG + Intronic
932328299 2:70879417-70879439 TCTGGTCCTGGACTATTTTGGGG - Intergenic
932523119 2:72434527-72434549 TCTGGTCCTGGACTTTTTTTGGG + Intronic
932595377 2:73089958-73089980 TCTGTTCCTGCATCTTGTAGAGG - Intronic
933094708 2:78163590-78163612 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
933950109 2:87321923-87321945 TCTTTTCCTGGCATTTGGTGAGG + Intergenic
934152911 2:89165901-89165923 TCTGGCCCTGGACTTTTTTTTGG + Intergenic
934214328 2:90016030-90016052 TCTGGCCCTGGACTTTTTTTTGG - Intergenic
934665888 2:96170436-96170458 TTTATTCATTGACTTTGTTGAGG - Intergenic
934956067 2:98620969-98620991 CATGTACCTGGACCTTGTTGGGG - Exonic
935602126 2:104933505-104933527 ACTGTCCCTGGACTTTATTAGGG - Intergenic
935604417 2:104956225-104956247 TCTGCTCCTGGACTTTTTTTTGG + Intergenic
936067136 2:109340873-109340895 ACTTTTCCCAGACTTTGTTGTGG - Intronic
936150905 2:110021959-110021981 TCTTCTCATGGTCTTTGTTGTGG - Intergenic
936193771 2:110349410-110349432 TCTTCTCATGGTCTTTGTTGTGG + Intergenic
936812317 2:116416929-116416951 TCTGGTCCTGGTCTTTTTTCTGG - Intergenic
936900442 2:117476064-117476086 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
937075196 2:119099218-119099240 TCTGTTCCTAGACTTTTTTTTGG - Intergenic
937143528 2:119622387-119622409 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
937186463 2:120048281-120048303 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
937561273 2:123227205-123227227 TCTTTCCTTGGACATTGTTGGGG + Intergenic
937633197 2:124126428-124126450 TCAGGTCCTGGACTTTTTTTTGG - Intronic
937646713 2:124273707-124273729 ACTCCTTCTGGACTTTGTTGGGG - Intronic
938217763 2:129535318-129535340 TCTGGTCTTGGACTTTTTTTTGG - Intergenic
938567473 2:132532364-132532386 TCTGGTCCTGGACTTTTTTTGGG - Intronic
938608814 2:132925114-132925136 TTTTTCCATGGACTTTGTTGGGG + Intronic
938857643 2:135330674-135330696 TCTGGTCCTGGACTTTTTTTTGG + Intronic
938909885 2:135876260-135876282 ACTGTTCCTGGACTTCTTGGAGG - Exonic
939840928 2:147185902-147185924 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
939841868 2:147198949-147198971 TCTTCTCCTGGACTTTGCTCTGG - Intergenic
939912700 2:148003131-148003153 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
940080271 2:149793242-149793264 TCTGGTCCTGTACTTTTTTTTGG + Intergenic
940121330 2:150269843-150269865 TCTGTTCCTGTATATTGTTTTGG + Intergenic
940208493 2:151231582-151231604 TCTGGTCCTGGGCTTTTTTCTGG - Intergenic
940394770 2:153175255-153175277 TCTGTCCCTAAACTTTGTAGGGG + Intergenic
940548212 2:155117157-155117179 TGTGATCCTGTAGTTTGTTGAGG - Intergenic
940819016 2:158330630-158330652 TCTGGTCCTGGACTTTTTTTTGG + Intronic
940821708 2:158363183-158363205 TCTGGTCCTGGACTTTTTTTTGG - Intronic
941141075 2:161782348-161782370 TCTCTTCCTGGACTTATTGGTGG + Intronic
941276915 2:163501189-163501211 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
941763269 2:169268126-169268148 TCTGGTCCTGGACATTTTTTGGG - Intronic
941845638 2:170129442-170129464 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
942350212 2:175044651-175044673 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
942744411 2:179215510-179215532 TCTGGTCCTGGACTTTTTTTTGG - Intronic
942978546 2:182049429-182049451 TCTTTTCCTGCACTATTTTGTGG - Intronic
943351030 2:186796495-186796517 TCTGGTCCTGGACTTTTTTCTGG - Intergenic
943351512 2:186802332-186802354 TCTGCTCCTGGGCTTTTTTCTGG + Intergenic
943517347 2:188905503-188905525 TCTCTTCCTTACCTTTGTTGTGG + Intergenic
943987562 2:194642296-194642318 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
944094409 2:195950227-195950249 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
944292371 2:198021764-198021786 TCTGGTCCTGGTCTTTTTTTTGG - Intronic
944925716 2:204462048-204462070 TCTGGTCCTGGACTTTTTTTGGG + Intergenic
944988444 2:205206068-205206090 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
945121494 2:206462073-206462095 TCTGTTTCTGGACTTCCTGGCGG - Intronic
945390979 2:209264890-209264912 TCTGGTCCTGGACCTTTTTTTGG - Intergenic
945554007 2:211256541-211256563 TCTGGTCCCGGACTTTTTTTTGG + Intergenic
945615255 2:212058309-212058331 TCTGGTCCTGGACTTTTTTTGGG - Intronic
945655907 2:212623725-212623747 TCAGTTCCTGGACTTTTCTTTGG - Intergenic
945725613 2:213469748-213469770 ACTGTTCCTTACCTTTGTTGTGG + Intronic
945844761 2:214930881-214930903 GCTGTTCATTGTCTTTGTTGTGG - Intergenic
947900352 2:233716793-233716815 TCTGTCTCTGGACGTTGCTGGGG + Intronic
947901753 2:233727169-233727191 TCTGTCTCTGGACTTTGCTGGGG + Intronic
948026175 2:234778987-234779009 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
948526112 2:238571788-238571810 CCTGCTCCTGGGCTGTGTTGCGG + Intergenic
948588001 2:239033015-239033037 TCTGAGCCTGGGCTTTTTTGTGG + Intergenic
1169319655 20:4621612-4621634 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1169418694 20:5441139-5441161 TCTGGTCCTGAACTTTTTTTTGG - Intergenic
1169435315 20:5582349-5582371 TCTTTTCCTTGATTTTGTTTGGG - Intronic
1169516112 20:6318446-6318468 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1171007654 20:21482613-21482635 TCTGGTCCTGGACTTTTTTTGGG + Intergenic
1171075426 20:22118129-22118151 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1171256908 20:23696048-23696070 TCTGGTCATGGACTTTTTTTTGG - Intergenic
1171410716 20:24946294-24946316 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1171897323 20:30820290-30820312 TCAGGTCCTGGGCTTTTTTGGGG + Intergenic
1173543562 20:43873757-43873779 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1174553521 20:51378296-51378318 TCTCTTCCTGGACTTTCCAGTGG - Intergenic
1176212491 20:63931813-63931835 TCTGTTCCATGTCTGTGTTGTGG + Exonic
1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG + Intronic
1177943064 21:27434563-27434585 TCTGGTCCTGGACTCTTTTTTGG + Intergenic
1178433980 21:32541214-32541236 TCTGTTCCAGGACCCTGTTTGGG - Intergenic
1179085754 21:38216165-38216187 TCTGTTCCTGGCCTCTTTTCTGG + Intronic
1179351654 21:40617090-40617112 TCTGTGCCTGGCCTTTGTTCTGG - Intronic
1180205644 21:46257945-46257967 TCTGTTGATGGACTTTCATGTGG - Intronic
1180317819 22:11291772-11291794 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1180541320 22:16450731-16450753 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1180591520 22:16941806-16941828 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1180640633 22:17295919-17295941 TCTGGTCCTGGACTTTATTTTGG + Intergenic
1181266938 22:21635951-21635973 CCAGTCCCTGGACTTTGCTGAGG + Intronic
1181364200 22:22362253-22362275 TCTGGTCCTGGACTTTTTTCGGG + Intergenic
1182938623 22:34252094-34252116 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1183250070 22:36724200-36724222 ACTGTGCCTGGCCTTTTTTGTGG - Intergenic
1183860956 22:40669550-40669572 CCTGTACCTGGACTTTGTTGGGG + Intergenic
949173617 3:1032510-1032532 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
949223838 3:1669878-1669900 TCTCTGCCAGGACTTTCTTGTGG - Intergenic
949225164 3:1685160-1685182 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
949597141 3:5559968-5559990 GCAGTGCCTGGAATTTGTTGAGG + Intergenic
949940797 3:9152684-9152706 TCAGTCCCTGGACATTGTGGTGG + Intronic
950187800 3:10956145-10956167 GCCATTCCTGCACTTTGTTGAGG + Intergenic
950414413 3:12860471-12860493 TCTGCTCCTGGGTTTTGTTCTGG - Intronic
950414687 3:12862168-12862190 TCTGTTCCTAGGTTTTGTTCTGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951012463 3:17696623-17696645 TCTGGTCCTGGACTTTTTTTTGG - Intronic
951182847 3:19679296-19679318 TCTGGTTCTGGACTTTTTTTTGG + Intergenic
952815658 3:37445227-37445249 TCTGGCCCTGGCCTCTGTTGAGG - Intergenic
953080996 3:39617617-39617639 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
953580238 3:44147241-44147263 CCTGAGCATGGACTTTGTTGGGG - Intergenic
954117041 3:48472728-48472750 TCTGTCCCTGGGCTGTGCTGTGG - Intronic
954276818 3:49547616-49547638 TGTATTCCTGGACTTCTTTGAGG + Intergenic
955049145 3:55392199-55392221 TCTGGTCGTGGACTTTTTTTTGG - Intergenic
955831806 3:63012681-63012703 TCTGGTCCTGGGCTTTTTTTGGG + Intergenic
956593598 3:70942975-70942997 TCTGGGCTTGGACTTTGTTTGGG - Intergenic
956668748 3:71666463-71666485 TCTGGTCCTGGGCTTTTTTTGGG - Intergenic
957102642 3:75847630-75847652 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
957104955 3:75875196-75875218 TCTGGTCCTGAACTTTTTTTTGG + Intergenic
957776820 3:84764537-84764559 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
958002581 3:87769848-87769870 TCTGCTCCTGTGCTTTTTTGAGG + Intergenic
958156106 3:89757761-89757783 TGTGCTGCTGGATTTTGTTGAGG + Intergenic
958553851 3:95648571-95648593 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
958770373 3:98418813-98418835 TCTGTTCTTGGACTTTTTGGTGG - Intergenic
959610822 3:108292942-108292964 TTTTGTCCTGGACATTGTTGAGG - Intergenic
959642657 3:108659011-108659033 TCTGGTCCTGGACTTTTTTTTGG - Intronic
959883213 3:111470507-111470529 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
960037600 3:113117499-113117521 TCTGGTCCTTGACTCCGTTGAGG - Intergenic
960069672 3:113414983-113415005 TCTGGTCCTGGAGTTTTTTTTGG + Intronic
960491302 3:118319652-118319674 TCTGTTCTTTTACTTTGCTGAGG + Intergenic
960612264 3:119565793-119565815 TCTGGTCCTGGATTTTTTTTTGG + Intergenic
960648864 3:119923441-119923463 TCTGGTGCTGGACTATGTTCCGG - Exonic
960779415 3:121302168-121302190 TCTGGTCCTGGACTTTTTTTTGG + Intronic
961108002 3:124258566-124258588 CCTCTTCCTGGATTTTGCTGGGG + Intronic
961310910 3:126000048-126000070 TCTGATCCTGGGCTTTTTTTTGG - Intergenic
962661213 3:137602144-137602166 ACTGTTCCTGGAGTCTGCTGGGG + Intergenic
962666360 3:137657709-137657731 TCTGGTCCTTGACTTTTTTTTGG - Intergenic
963576240 3:147064314-147064336 TCTGGTCCTGGAGTTTTTTTTGG - Intergenic
963675397 3:148304593-148304615 TCTGGTCCTGGACTCTTTTTGGG - Intergenic
963980576 3:151532200-151532222 TCTGGCCTTGGACTTTTTTGTGG - Intergenic
964214654 3:154266087-154266109 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
964245467 3:154647698-154647720 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
964610193 3:158605104-158605126 TCAATGGCTGGACTTTGTTGAGG - Exonic
965216584 3:165871784-165871806 TCTGGTACTGGACTTTTCTGTGG + Intergenic
965227536 3:166008655-166008677 TCTGATCCTGGAATTTTTTTTGG + Intergenic
965292867 3:166906509-166906531 TCTAGTCCTGGACTTTTTTTTGG + Intergenic
968388549 4:168473-168495 TCTGGTGCTGGACTTTTTTTTGG + Intergenic
969165080 4:5301171-5301193 TCTGTTCCTAGCTTTCGTTGAGG + Intronic
969747388 4:9084046-9084068 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
969782087 4:9413473-9413495 TCTGGTCCTGGACTTTTATTGGG + Intergenic
970022001 4:11579999-11580021 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
970864393 4:20742089-20742111 TCTGGTCCTGGACTTTTTTTTGG - Intronic
971034618 4:22679466-22679488 TCTGTTCATGGAATTTGGAGAGG - Intergenic
971438336 4:26652335-26652357 TCTGGTCCTGGACTTTTTTTTGG + Intronic
971734199 4:30425214-30425236 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
972031900 4:34471122-34471144 CCAGTTGCTGGACTATGTTGTGG + Intergenic
973679453 4:53301470-53301492 TCTGGTCCTGGAGTTTTTTTTGG - Intronic
973883855 4:55300653-55300675 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
974141803 4:57897357-57897379 TCTGGTCCTGGACTCTTTTTGGG + Intergenic
974280253 4:59782816-59782838 TCTGTTTCTAGACTTTTTGGGGG - Intergenic
974347372 4:60699337-60699359 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
974363806 4:60918701-60918723 TCTGGCCCTGGACTTTTTTTTGG - Intergenic
974371430 4:61021521-61021543 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
974536449 4:63181465-63181487 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
974701177 4:65449448-65449470 TCTGTTCTTGGGTTTTGTTGTGG - Intronic
975022509 4:69506591-69506613 TCTGGTCCTAGGCTTTGTTTGGG - Intronic
975056014 4:69929771-69929793 TCTGGTCCTGGCCTTTTTTTTGG + Intergenic
975149080 4:71001608-71001630 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
975260763 4:72295366-72295388 TCTATTCCTTGACTTTTTTTGGG - Intronic
975301155 4:72792660-72792682 TCTAGTCCTGGACTTTTCTGGGG - Intergenic
975379824 4:73686743-73686765 TCTGATCCTGGGCTTTTTGGGGG - Intergenic
975491312 4:74991839-74991861 ACTGTTCTTGAACTTTGTTCTGG - Intronic
975529032 4:75381625-75381647 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
975570149 4:75808168-75808190 TCTTTTCCTGTACTTTTTTTGGG + Intronic
975660775 4:76687012-76687034 TCTGGTGCTGGAGTGTGTTGTGG - Intronic
975792681 4:77971541-77971563 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
975807134 4:78124595-78124617 TCTGGTCCTGGACTTTTTTTTGG + Intronic
976455288 4:85239710-85239732 TCTGGTCCTGGGCTTTTTTTCGG - Intergenic
976532078 4:86167237-86167259 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
976537864 4:86239469-86239491 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
976992035 4:91379373-91379395 TCTGGTCCTGGACTTTTTTTTGG + Intronic
977420948 4:96798887-96798909 TCTGGTCCTGGACTCTTTTTTGG - Intergenic
977442230 4:97082726-97082748 TCTGGTTCTGGACTTTTTTTTGG + Intergenic
977502873 4:97863467-97863489 TCTGGTCCTGGACTTTTTTTTGG - Intronic
977929932 4:102739323-102739345 TCTGGTCCTGGACTTTTTTTTGG - Intronic
978140236 4:105309861-105309883 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
978236587 4:106468174-106468196 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
978590956 4:110324443-110324465 TCTGGTCCTGGACTTTTTTTGGG + Intergenic
978683438 4:111411410-111411432 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
979017152 4:115449240-115449262 TCTGGTCCGGGACTTTTTTTTGG + Intergenic
979421709 4:120512631-120512653 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
979583568 4:122388489-122388511 TCTGGTCCTGGACTTTTTTTTGG + Intronic
979911980 4:126378978-126379000 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
979925262 4:126555220-126555242 TCTTGTCCTGGACTTTTTTTTGG - Intergenic
979953047 4:126919376-126919398 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
980317319 4:131219055-131219077 TTTGGTCCTGGACTTTTTTTTGG + Intergenic
981103059 4:140851898-140851920 TCTGTTCCAGGATTTCATTGAGG + Intergenic
981520383 4:145655320-145655342 TCTGTTCCCGGACTGTGGGGTGG - Exonic
981794611 4:148582117-148582139 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
982059897 4:151594363-151594385 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
982141363 4:152322892-152322914 GCTGGTGCTGGACTTTGATGTGG - Exonic
982826054 4:160005194-160005216 TCTGGTCCTGGACTTTATTTTGG - Intergenic
982870863 4:160577414-160577436 TCTGGTCCTGGACTCTTTTTTGG - Intergenic
983277769 4:165639091-165639113 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
984936589 4:184895225-184895247 TCTCTTCCTGGACTGTGTGGTGG + Intergenic
985029356 4:185773262-185773284 TTTGAGCCTGGGCTTTGTTGGGG - Intronic
986217643 5:5735124-5735146 TCTGGTCCTGGGTTTTTTTGAGG + Intergenic
986379947 5:7174067-7174089 TCTGGTCCTGGACTCTTTTTTGG - Intergenic
986490457 5:8284189-8284211 TCTGGTTCTGGACTTTTTTTTGG - Intergenic
987088848 5:14493032-14493054 TCTGTTCTAGCACATTGTTGAGG + Intronic
987179344 5:15350334-15350356 TCTGTTTCTAGGATTTGTTGTGG - Intergenic
987414186 5:17645893-17645915 TCTGGTCCTGGACATTTTTTTGG + Intergenic
987444890 5:18005394-18005416 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
987517419 5:18930786-18930808 TCTGTTCCAGAACTTGTTTGTGG + Intergenic
987606070 5:20137833-20137855 TATGATCCTGGACTTTTTTTTGG - Intronic
988070961 5:26287441-26287463 TCTTGTCCTGGACTTTTTTCTGG - Intergenic
988554211 5:32222400-32222422 CCTGTTCTTAGACTTTGTGGAGG + Intergenic
988777945 5:34494100-34494122 TCTGTTTCTTGATTTTTTTGGGG - Intergenic
989614439 5:43325509-43325531 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
989845387 5:46134376-46134398 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
990192167 5:53271508-53271530 TCTGGTCCTGGACTCTTTTTGGG - Intergenic
990504467 5:56430849-56430871 TCTGTTCCTGGACTATCTCCTGG + Intergenic
990666742 5:58081016-58081038 TCTGTTCTTGGACTCCGTGGAGG - Intergenic
992206571 5:74435979-74436001 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
992316673 5:75563271-75563293 TCTGGTCCTGGACTTTTTTTTGG + Intronic
992370066 5:76134571-76134593 TTTGTTCCTGGTCTTCCTTGAGG - Intronic
992513890 5:77471797-77471819 TCTGGTCCTGGATTTTTTTTTGG - Intronic
993438000 5:87921601-87921623 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
993888166 5:93441383-93441405 TCTCTTCTTTGACTTTTTTGAGG - Intergenic
993948285 5:94141166-94141188 TCTGGTCCTGGACATTTTTTTGG + Intergenic
994468898 5:100176974-100176996 TCTGGTCCTGGACTTGTTTTTGG - Intergenic
994499562 5:100557558-100557580 TCTGGTCCTGGACTCTTTTTTGG + Intronic
994510957 5:100703193-100703215 TCTGTTCCTGGACTTTTTTTTGG - Intergenic
994574931 5:101566129-101566151 TCTGTTCCTGGGCTTTTTTTTGG + Intergenic
994861479 5:105201323-105201345 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
994962689 5:106625403-106625425 TCTGGTCCTGGACTCTTTTTTGG + Intergenic
995307385 5:110669500-110669522 TCTGGTCCTTGACTTTTTTTTGG - Intronic
995570678 5:113477820-113477842 TGTTTTCCTATACTTTGTTGTGG - Intronic
996141061 5:119909907-119909929 TCTGGTCCTGGATTTTTTTTTGG + Intergenic
996632106 5:125645773-125645795 TCTGGTCCTGGACGTTTTTCTGG - Intergenic
996878648 5:128268394-128268416 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
997115237 5:131119465-131119487 TCTGGTCCTGGACTTGTTTTGGG + Intergenic
997171496 5:131726316-131726338 TCTGGTCCTGGACTTTTTTTTGG + Intronic
997201179 5:132011164-132011186 TCTGTTCCTGGCCTTGGCTCAGG + Intronic
997204766 5:132040325-132040347 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
997230110 5:132236114-132236136 TCTGTTCTTGTACTTTCTGGGGG - Intronic
997430439 5:133835454-133835476 CCTGTTCCTGAAATTTGTTCAGG + Intergenic
997861375 5:137420418-137420440 TCTGGTCCTGGACTTTTTTTTGG + Intronic
997903078 5:137786456-137786478 TTTGGTCCTGGACTTTTTTTTGG - Intergenic
998009327 5:138681300-138681322 TCTGGTCCTGGACTTTTTTCTGG + Intronic
998645059 5:144052539-144052561 TCTGGTCCTGGACTTTTGGGTGG + Intergenic
998694738 5:144626437-144626459 GCTGGTCCTGGACTTTTTTTTGG + Intergenic
999156459 5:149461050-149461072 TCAGTTCTTGGAGTCTGTTGTGG + Intergenic
999646927 5:153726755-153726777 TCTGGTCCTGGACTTTTTGTTGG - Intronic
1000276526 5:159741478-159741500 TCTGTACCTGGAATTTGGTGGGG - Intergenic
1000521815 5:162304696-162304718 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1000577830 5:162996984-162997006 TCTTTTCCTGCACTGTGTTGAGG + Intergenic
1000598158 5:163239665-163239687 TCTGGTCCTGGACTTTTTCTGGG - Intergenic
1001649491 5:173305301-173305323 TTGGTTCCTGGACTGTGCTGGGG + Intergenic
1002003284 5:176211219-176211241 TCTGGCCCTGGGCTTTTTTGTGG + Intergenic
1002084085 5:176760089-176760111 TCTGTTTCTGGACTTTATTCTGG - Intergenic
1002174767 5:177395553-177395575 TCAGAGCCTGGACTTTATTGAGG + Intronic
1002223168 5:177699725-177699747 TCTGGCCCTGGGCTTTTTTGTGG - Intergenic
1002734478 5:181374186-181374208 TCTGGTCCTGGACTGTTTTTTGG + Intergenic
1002750057 6:99938-99960 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
1002814181 6:663314-663336 TCTGGTCCTGGACTTTTCTTTGG - Intronic
1004825952 6:19421496-19421518 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1004831843 6:19485246-19485268 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1004944145 6:20593291-20593313 TGTGGTCCTGGGCTTTGTTTTGG + Intronic
1005182550 6:23122586-23122608 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1005378607 6:25210746-25210768 TCTGGTCCTGGGCTTTGTTTGGG - Intergenic
1005779891 6:29179212-29179234 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1006200278 6:32282187-32282209 TCTGCTCCTGGGCTTTTTTGGGG - Intergenic
1008163432 6:48105970-48105992 TCTTGTCCTGGACTTTTTTTTGG - Intergenic
1008207685 6:48683482-48683504 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1008998170 6:57683007-57683029 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1009186668 6:60582371-60582393 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1009291765 6:61891555-61891577 TCTGGTCCTGGACTGTTTTTGGG + Intronic
1009495717 6:64344076-64344098 TCTTGTCCTGGACTTTTTTTTGG - Intronic
1009521460 6:64687842-64687864 TCTGGTCCTGGAATTTTTTTTGG + Intronic
1009580944 6:65533353-65533375 TCTGGGCCTGGACTTTTTTTTGG - Intronic
1009591270 6:65673732-65673754 TCTGTTACTGGACTGTATAGAGG + Intronic
1009741182 6:67748043-67748065 TCTCTTCCTTACCTTTGTTGAGG - Intergenic
1010731053 6:79391709-79391731 TCTGTCCCTTCACATTGTTGTGG - Intergenic
1011063336 6:83296038-83296060 TCAGTTCCTGGGCTTTTTTGGGG - Intronic
1011142913 6:84179863-84179885 TCTGGTCCTGTACTTTTTTTTGG - Intronic
1011188266 6:84702853-84702875 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1011229838 6:85148225-85148247 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1011572796 6:88757252-88757274 GCTTTTCCTTGAATTTGTTGTGG - Intronic
1011657734 6:89566664-89566686 TCTGTTCAGGGGCTTTGCTGTGG + Intronic
1011875751 6:91959121-91959143 TCTGGTCCTGGACTTTTTTGGGG - Intergenic
1011965556 6:93153173-93153195 TCTGGTCTTGGACTTTTTTTTGG + Intergenic
1012480110 6:99657378-99657400 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1012514434 6:100042275-100042297 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1012888532 6:104873139-104873161 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1012965915 6:105672912-105672934 TCTGATTCTGGACTTTTTTTTGG - Intergenic
1013124195 6:107167099-107167121 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1013200389 6:107889212-107889234 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1013288843 6:108703391-108703413 TCAATTCCTGGACTATGTTAAGG - Intergenic
1013449187 6:110262487-110262509 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1013955511 6:115836132-115836154 TTTGAACCTGGACATTGTTGAGG - Intergenic
1014332434 6:120086482-120086504 TCTGGTCCTGGACGTTTTTTTGG - Intergenic
1014347726 6:120295164-120295186 TCTGGTCCTGGACGTTTTTTTGG + Intergenic
1014367228 6:120559784-120559806 TCTGGTCCTGGCCTTTTTTGGGG + Intergenic
1014938244 6:127409219-127409241 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1015000010 6:128202773-128202795 TCTGATCCTGGGCTTTATTTTGG - Intronic
1015131051 6:129809643-129809665 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1015200099 6:130569959-130569981 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1015201493 6:130586438-130586460 TATGTTCCAGAAATTTGTTGTGG - Intergenic
1015707291 6:136102002-136102024 GTTGTTCCTGGTCTCTGTTGTGG + Intronic
1015741324 6:136457341-136457363 TCTGGTCCTGAGCTTTTTTGGGG - Intronic
1016498831 6:144694511-144694533 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1017405686 6:154115983-154116005 TCTCATCCTGGGCTTTGTTTTGG + Intronic
1019203288 6:170337652-170337674 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1020207881 7:6133054-6133076 TCTACTCCTGGAATTTGTTGAGG + Intronic
1020325611 7:6972599-6972621 TCTGTTCCTGGACTTTTTTTTGG + Intergenic
1020659209 7:10962699-10962721 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1022072735 7:26933620-26933642 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1022615949 7:31930278-31930300 TCTGGTCCTGGACTTCTTTTTGG - Intronic
1022655052 7:32311273-32311295 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1023510782 7:40951081-40951103 TCTGGTCCTGGACTTTTTTTGGG + Intergenic
1023839582 7:44088784-44088806 TCTATTCCTGCACATTGCTGTGG + Intergenic
1023872102 7:44268800-44268822 TCTCTTCCTGCACTTGGCTGTGG - Intronic
1024031560 7:45465117-45465139 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1024150029 7:46562014-46562036 TCTGTTCCTGGGCTTTCTTTGGG - Intergenic
1024153260 7:46594413-46594435 TCTGCTCCTGGACTTCTTTTTGG - Intergenic
1024383964 7:48730314-48730336 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
1024460348 7:49653247-49653269 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1024461592 7:49665315-49665337 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1024552968 7:50578779-50578801 TTTGTTCCTGGACTTGGTATCGG + Intergenic
1024665283 7:51540587-51540609 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1024892665 7:54221620-54221642 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1024901251 7:54320767-54320789 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1025849823 7:65236736-65236758 TCTGTTCCTCACCTCTGTTGTGG - Intergenic
1025857630 7:65296899-65296921 TCTGGCCCTGGACTTTTTTTTGG + Intergenic
1027276615 7:76563819-76563841 TCTGGTCCTGGACCTTTTTTTGG + Intergenic
1027732980 7:81899451-81899473 TCTGGTCCTGGACTTTTTGGTGG + Intergenic
1027734213 7:81912266-81912288 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1027792591 7:82652351-82652373 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1027923146 7:84422138-84422160 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1028100060 7:86808368-86808390 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1028168145 7:87563182-87563204 TCTGGTCCTGGGCTTTTTTAGGG - Intronic
1028218020 7:88159275-88159297 TCTGGTCCTGGCCTTTTTTTTGG - Intronic
1028274685 7:88840137-88840159 TCTGTGCCAGAACTTTGTTCTGG - Intronic
1028652537 7:93167060-93167082 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1028785154 7:94784315-94784337 TCTGTTCCTGGGCTTTTTTTTGG - Intergenic
1028961937 7:96758773-96758795 CCTGGTCCTGGACTTTCTTTTGG + Intergenic
1029189312 7:98760598-98760620 CCTCTTCCTGGACTTTGTCCTGG + Intergenic
1029844829 7:103402182-103402204 TTTGGTCCTGGACTTTTTTTTGG + Intronic
1030134141 7:106230284-106230306 TCAGGTCCTGGGCTTTGTTTTGG + Intergenic
1030449393 7:109689751-109689773 TTTGGTCCTGGACTTTTTTTTGG + Intergenic
1030456136 7:109776320-109776342 TCTGGTCCTGCACATTTTTGTGG - Intergenic
1030793459 7:113758185-113758207 TATGGTCCTGGACTTTTTTGTGG - Intergenic
1031241321 7:119244738-119244760 TCTGTTCCTCTACTTTATTCTGG + Intergenic
1031391759 7:121223580-121223602 TCAGGTCCTGGACTTTTTTTTGG + Intronic
1031612245 7:123841614-123841636 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1032250385 7:130251644-130251666 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1032786755 7:135207173-135207195 TGTGATCCTGAACTTTGATGCGG - Exonic
1033293154 7:140105911-140105933 TCTGGTCCTGGACTTTTTTTGGG + Intronic
1033605188 7:142921860-142921882 TCAGTTCCTAGACTTTGGTGAGG + Intronic
1034379844 7:150681921-150681943 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1034628422 7:152512066-152512088 TTTGGTCCTGCACTTGGTTGAGG + Intergenic
1034655206 7:152723673-152723695 TCTGGTTCTGGATTTTGTGGGGG - Intergenic
1034792082 7:153980166-153980188 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1034937082 7:155207133-155207155 GGTGCTCCTGGATTTTGTTGGGG + Intergenic
1035509041 8:160106-160128 TCTGGTCCTGGACTGTTTTTTGG - Intergenic
1035798421 8:2381296-2381318 TCTGGTCCAGGGCTTTTTTGGGG + Intergenic
1035881950 8:3252683-3252705 TCTGGTCCTGGACTTTTTTTAGG + Intronic
1036128761 8:6088394-6088416 TCTGGTTCTGGACTTTTTTTTGG + Intergenic
1036837049 8:12080962-12080984 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
1036858843 8:12327207-12327229 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
1037371163 8:18180449-18180471 TCTGCTCCAGTATTTTGTTGAGG + Intronic
1037528721 8:19753505-19753527 TCTGTTGCTAGTTTTTGTTGTGG + Intronic
1037619293 8:20549302-20549324 TCTCTTGCTGGACTTTGTGATGG - Intergenic
1039004879 8:33024190-33024212 TCTGTTTCTGGAAGTTCTTGTGG + Intergenic
1039154866 8:34543739-34543761 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1040519773 8:48165986-48166008 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1040910155 8:52509979-52510001 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1041293977 8:56335382-56335404 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1042108338 8:65352712-65352734 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1042146083 8:65731851-65731873 TCTGTACTTGGACTTTCTTATGG + Intronic
1042160851 8:65893460-65893482 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1042394821 8:68279801-68279823 TCTGGTCCTAGACTTTTTTTTGG - Intergenic
1042489830 8:69384600-69384622 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1042534667 8:69846793-69846815 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1043231444 8:77806850-77806872 TCTGGTCCTGGACTTTTCTTAGG - Intergenic
1043276886 8:78408573-78408595 TCTGTTCCAGGCCTTTCTTCCGG - Intergenic
1043324865 8:79037430-79037452 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1043617604 8:82145992-82146014 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1043642119 8:82467461-82467483 TCTGGTCCTGGACTTTTTTGTGG - Intergenic
1043784778 8:84385051-84385073 TACTTTCCTGGACTTTGTGGGGG - Intronic
1043845149 8:85154794-85154816 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1044003868 8:86917805-86917827 TCTTTTTCTGGACTTGGTTTGGG - Intronic
1044368062 8:91373846-91373868 TCTGGTCCTGGACTTCTTTTTGG + Intronic
1044384451 8:91570799-91570821 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1044808750 8:96035734-96035756 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1046067655 8:109215649-109215671 TCTGATCCTGGGCTTTTTTTTGG + Intergenic
1046114939 8:109773553-109773575 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1046243377 8:111527491-111527513 TCTGTTACTGAATTTTTTTGGGG + Intergenic
1046592076 8:116218986-116219008 TCAACTCCTGGGCTTTGTTGAGG - Intergenic
1048232277 8:132655271-132655293 TCTGGTCCTGGACTTTTCTTTGG - Intronic
1048242360 8:132755451-132755473 CTTGTTGCTGGACTTTGCTGTGG - Intronic
1048388444 8:133936315-133936337 TCTATTTCTGGACTTTATTCTGG + Intergenic
1048428996 8:134350871-134350893 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1048568463 8:135629065-135629087 TAAGTTCCTGCACTTTGTAGTGG + Intronic
1049102064 8:140587080-140587102 TCTGTGCCTGGACTCTGCTTGGG - Intronic
1049136393 8:140904619-140904641 TCTGGTCCTGGGCTTTTTTTTGG + Intronic
1050497580 9:6260638-6260660 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1050864050 9:10475503-10475525 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1051113193 9:13663639-13663661 TCTGGTCCTGGACTTTCTTTTGG - Intergenic
1051205389 9:14683570-14683592 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1051238680 9:15028707-15028729 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1051373547 9:16380357-16380379 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1051564081 9:18476715-18476737 TCTATTCTTGGACTTATTTGGGG + Intronic
1051887694 9:21912151-21912173 TCTGGTCCTGGACTGTTTTTTGG - Intronic
1052307507 9:27027332-27027354 TCTGGTCCTGGACTTTTTGTTGG - Intronic
1052465222 9:28821424-28821446 TCTATTACTTGCCTTTGTTGGGG - Intergenic
1052705835 9:31992450-31992472 TCTGTTCTTTTACATTGTTGAGG - Intergenic
1053041944 9:34881731-34881753 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1055622071 9:78136665-78136687 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1056186782 9:84143040-84143062 TATGTTACTGGAATTTCTTGTGG + Intergenic
1056230997 9:84543628-84543650 TCTATTCTTTGAATTTGTTGAGG + Intergenic
1057119139 9:92555189-92555211 TCTGGTCTTGGACTTTTTTTTGG + Intronic
1057697682 9:97337785-97337807 TCTGGTCCTGGACATTTTTCTGG + Intronic
1058192687 9:101938029-101938051 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1058386247 9:104439465-104439487 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1058666843 9:107326544-107326566 TCTGGTCCTGGGCTTTTTTTGGG + Intronic
1060339652 9:122763350-122763372 TCTGGTCCTGGACTTTTTTTCGG - Intergenic
1061491135 9:130944851-130944873 TCCCTTCCTGGACTTTGGTGTGG - Intergenic
1062725050 9:138068136-138068158 CCTGTCCCTGGCCTTTGTTGTGG - Intronic
1062758931 9:138326793-138326815 TCTGGTCCTGGACTGTTTTTTGG + Intergenic
1186260227 X:7769684-7769706 TCTGATCCAGGACTTTATAGTGG + Intergenic
1186406248 X:9306218-9306240 TCTGTTTTTGGAATTTCTTGAGG - Intergenic
1186533460 X:10321719-10321741 TCTGTTCATGGTCTTTTGTGAGG + Intergenic
1186783089 X:12933101-12933123 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1186964336 X:14771859-14771881 TCTGTTTGTGCAGTTTGTTGGGG + Intergenic
1187211116 X:17232641-17232663 TCTGGTCCTGGACTTTTTGTTGG + Intergenic
1187596115 X:20774683-20774705 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1188010580 X:25051625-25051647 TCTGTTTCTAGACTTTTTTGGGG + Intergenic
1188164036 X:26839175-26839197 TCTGGTCCTGGGCTTTATTTTGG - Intergenic
1188290973 X:28388438-28388460 TCTGGTCCTGGACTCTTTTTTGG + Intergenic
1188590515 X:31828745-31828767 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1188974322 X:36655154-36655176 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1189381611 X:40506405-40506427 TTACTTCCTGGACTTTGGTGGGG + Intergenic
1189599865 X:42612406-42612428 TGTGGTCCTGGACTTTTTTTTGG + Intergenic
1190038207 X:47046626-47046648 GGTGTTCCAGTACTTTGTTGAGG - Intronic
1190523767 X:51307609-51307631 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1190979815 X:55446778-55446800 TCTGCTCCTGGACTTTTTTTGGG - Intergenic
1191027582 X:55931006-55931028 TCTGGTCCTGGGTTTTGTTTTGG + Intergenic
1191111706 X:56808379-56808401 TCTGGTCCTGGACTCTTTTTTGG + Intergenic
1191122187 X:56917755-56917777 TCTGTTTCTAGACTTTTTTTTGG + Intergenic
1191196389 X:57728103-57728125 TCTGGTCCTGGACTTTTTTTGGG + Intergenic
1191209139 X:57866662-57866684 CCTGGTCCTGGACTTTTTTTTGG - Intergenic
1191582779 X:62783329-62783351 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1191591616 X:62891608-62891630 TCTGGTCCTGGCCTTTTTTTTGG - Intergenic
1191644249 X:63462935-63462957 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1191733779 X:64367128-64367150 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1191824490 X:65349873-65349895 GTTGTTCCTGGACTTTTTTTTGG - Intergenic
1191829079 X:65395808-65395830 TCTGGTCCTGGCCTTTCTTTTGG + Intronic
1191874249 X:65778858-65778880 TCTGGTCCTGGCCTTTTTTTTGG - Intergenic
1191907082 X:66104925-66104947 TCTGGTCCTGGACTTTTTTTGGG + Intergenic
1191950638 X:66587897-66587919 TCTGGTCCTGGGCTTTATTTTGG + Intergenic
1192396203 X:70783846-70783868 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1192540792 X:71970353-71970375 TCTGGGCCTGGACTTTTTTATGG + Intergenic
1192613219 X:72588948-72588970 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1192675186 X:73188359-73188381 TCTGGTCCTGGAATTTTTTTTGG - Intergenic
1192802220 X:74477100-74477122 TCTGGTCTTGGACTTTTTTTTGG + Intronic
1192923347 X:75730858-75730880 TCTGGTCCTGGGCTTTTTTGTGG + Intergenic
1192932118 X:75817699-75817721 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1192985446 X:76394190-76394212 TCTGGTCCTGGACTGTTTTTGGG + Intergenic
1193123123 X:77844069-77844091 TCTGGTCCTGGACTTTTTTTTGG + Intronic
1193284274 X:79693604-79693626 TCTGGTCCTGGGCTTTTTTTGGG + Intergenic
1193394227 X:80965115-80965137 TCTGGTCCTCGACTTTTTTTTGG + Intergenic
1193400411 X:81036178-81036200 TCTGTTTCTGGGCTTTGTTTTGG - Intergenic
1193419595 X:81267837-81267859 TCTGGTCCTGGACTTTTTTTGGG + Intronic
1193612740 X:83652190-83652212 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1193814400 X:86087351-86087373 TCTGGTCCTGGATTTTTTTTTGG - Intergenic
1194287115 X:92023534-92023556 TCTGGTCCTGGGCTTTTTTTTGG - Intronic
1194406111 X:93497625-93497647 TCTGATCCTGGACTTTTTTTTGG - Intergenic
1194448793 X:94016908-94016930 TCTGTTCCTGGGCTTAACTGAGG + Intergenic
1194508766 X:94766212-94766234 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1194609230 X:96020430-96020452 TTTAGTCCTGGACTTTGTTGAGG - Intergenic
1194630547 X:96277655-96277677 TCTGCTCGTGGACTTTGTTTTGG - Intergenic
1194770182 X:97893735-97893757 TCTGGTCCTGGACATTTTTTTGG + Intergenic
1194962657 X:100253586-100253608 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1195332443 X:103814956-103814978 TCTAGTCCTGGACTTTTTTTTGG - Intergenic
1195728952 X:107946056-107946078 TCTGGTCTTGGACTTTGTTTTGG + Intergenic
1195794697 X:108632349-108632371 TCTGGTCCTGGACTTCTTTTGGG - Intronic
1195798897 X:108684622-108684644 TCTGGTCCTGGACTTTTTTTGGG - Intronic
1195843937 X:109205928-109205950 TCTGGTCCTGGGCTTTTTTGGGG + Intergenic
1195846268 X:109232306-109232328 TCTGGTCCTGGACTTTTTTTGGG - Intergenic
1196068683 X:111495054-111495076 TCTATCCCTGGACTTTGCTTTGG - Intergenic
1196325496 X:114397575-114397597 TCTGGTCCTGGACTTCTTTTTGG - Intergenic
1196927732 X:120650141-120650163 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1196949621 X:120864057-120864079 TCTGGTCCTGGGTTTTTTTGGGG + Intergenic
1197094569 X:122577853-122577875 TCTGGTCCTGGGCTTTTTTTTGG - Intergenic
1197120356 X:122883663-122883685 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1197142072 X:123129032-123129054 ACTGGTCCTGGACTTTTTTTTGG - Intergenic
1197432780 X:126386653-126386675 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1197602954 X:128552394-128552416 TCTGCTCCTGGACTTTCTCCTGG - Intergenic
1197677429 X:129345755-129345777 TCTGTTCCTGGGTCCTGTTGGGG + Intergenic
1198124073 X:133624680-133624702 TCTGGTCCTGGACTTTTTTTTGG - Intronic
1198165028 X:134046789-134046811 TCTGCTCCTGGACTTTTTTTTGG + Intergenic
1198306409 X:135388169-135388191 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1198784151 X:140269500-140269522 TCTGATCCTGGGCTTTTTTTTGG + Intergenic
1198921518 X:141733875-141733897 ACTTTTCCTGGTCTTTGTGGAGG + Intergenic
1199061479 X:143360448-143360470 TCTGGTCCTGGGCTTTGCTTTGG + Intergenic
1199067905 X:143442045-143442067 TCTGGTCCTGGGCTTTTTTTTGG + Intergenic
1199119589 X:144035880-144035902 TCTATTCCTGGTTTTTGTTAAGG - Intergenic
1199206180 X:145151258-145151280 TCTGGTCCTGGACTTTTTTTTGG - Intergenic
1199667062 X:150105066-150105088 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1199706795 X:150434025-150434047 TCTGGTCCTGGGCTTTTTTCTGG + Intronic
1199878341 X:151953208-151953230 TCTGTGTCTGTAATTTGTTGGGG - Exonic
1199939307 X:152609178-152609200 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1200371100 X:155725440-155725462 TCTGGTCCTGGACGTTTTTTTGG + Intergenic
1200717121 Y:6560364-6560386 TCTAATCCTGGACTTTTCTGGGG - Intergenic
1200955936 Y:8945668-8945690 TCTGGTCCTGGACATTTTTTTGG + Intergenic
1201262251 Y:12170935-12170957 TCTGGTCCTGGACTCTTTTTTGG + Intergenic
1201625448 Y:16009847-16009869 TCTGGTCCTGGAATTTTTTTTGG + Intergenic
1201925823 Y:19286525-19286547 TCTTGTCCTGGACTTTTTTTTGG + Intergenic
1201956269 Y:19626763-19626785 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1201957636 Y:19643516-19643538 TCTGGTCCTGGAATTTTTTTTGG + Intergenic
1202057041 Y:20845305-20845327 TCTGGTCCTGGACTTTTTTTTGG + Intergenic
1202105323 Y:21357908-21357930 TCTGGTCCTGGAGTTTTTTTTGG - Intergenic