ID: 1070411949

View in Genome Browser
Species Human (GRCh38)
Location 10:76149993-76150015
Sequence GGCCATTTGCTGCTTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070411946_1070411949 -4 Left 1070411946 10:76149974-76149996 CCAGGGCTCCCTAGGGTTTGGCC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG No data
1070411944_1070411949 0 Left 1070411944 10:76149970-76149992 CCAACCAGGGCTCCCTAGGGTTT 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070411949 Original CRISPR GGCCATTTGCTGCTTCCCAC AGG Intronic
No off target data available for this crispr