ID: 1070415293

View in Genome Browser
Species Human (GRCh38)
Location 10:76183631-76183653
Sequence AAGATCCATGTGGGTACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070415289_1070415293 0 Left 1070415289 10:76183608-76183630 CCCAAGGAGGGAATAAGCAGATC 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1070415293 10:76183631-76183653 AAGATCCATGTGGGTACAGAAGG No data
1070415290_1070415293 -1 Left 1070415290 10:76183609-76183631 CCAAGGAGGGAATAAGCAGATCA 0: 1
1: 0
2: 0
3: 9
4: 168
Right 1070415293 10:76183631-76183653 AAGATCCATGTGGGTACAGAAGG No data
1070415286_1070415293 15 Left 1070415286 10:76183593-76183615 CCAGATTTATGAATACCCAAGGA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1070415293 10:76183631-76183653 AAGATCCATGTGGGTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070415293 Original CRISPR AAGATCCATGTGGGTACAGA AGG Intronic
No off target data available for this crispr