ID: 1070415847

View in Genome Browser
Species Human (GRCh38)
Location 10:76188544-76188566
Sequence TTAGACACATTCCACCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070415847_1070415850 4 Left 1070415847 10:76188544-76188566 CCCAGATGGTGGAATGTGTCTAA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1070415850 10:76188571-76188593 GGCAACCCATATTCACCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070415847 Original CRISPR TTAGACACATTCCACCATCT GGG (reversed) Intronic
902178828 1:14672121-14672143 TTAGACAAATTCTGCCAGCTTGG - Intronic
902262296 1:15235795-15235817 GTAGAGACATTTCACCATGTTGG + Intergenic
903429469 1:23282319-23282341 AAAGACACATTCCGCCATCCTGG - Intergenic
906895753 1:49769270-49769292 TCAGAGATATTTCACCATCTTGG - Intronic
907992963 1:59600679-59600701 TTATACACATTACCCCATCTAGG + Intronic
909435659 1:75638818-75638840 TTAGATTCATTCCAATATCTTGG + Intergenic
909470784 1:76025521-76025543 ATAGCCACATTGCACCATCTGGG - Intergenic
910437294 1:87218245-87218267 ACAGACTCATTCTACCATCTGGG + Intergenic
910677773 1:89832075-89832097 TTAGCCCCTCTCCACCATCTGGG + Intronic
912051653 1:105536697-105536719 TTAGGCAAATTCCACTAACTTGG + Intergenic
914841356 1:151251572-151251594 TGAGACAGATTTCACCATGTTGG + Intergenic
915746831 1:158167513-158167535 ATAGGCACATGCCACCAGCTTGG + Intergenic
921379133 1:214505752-214505774 ACAGACACATGCCACCACCTCGG - Intronic
922441101 1:225655435-225655457 TAAGACATATTGAACCATCTTGG + Intergenic
923263580 1:232290563-232290585 CTAGAAGCATTCCTCCATCTAGG + Intergenic
1063611655 10:7567957-7567979 TTACACACATGCTACCTTCTGGG - Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1073455108 10:103632023-103632045 ACAGACACATACCACCACCTAGG - Intronic
1078327035 11:10389248-10389270 TTTCCCTCATTCCACCATCTTGG + Intronic
1079063150 11:17267208-17267230 AGAGACACATTTCACCATGTTGG + Intronic
1079712470 11:23703464-23703486 GTAGACACATTCTACCATGTTGG - Intergenic
1079910860 11:26307512-26307534 GTAGAGACATTTCACCATATTGG - Intergenic
1080610439 11:33899565-33899587 TGAGAGGCATTCCAGCATCTGGG - Intergenic
1081040811 11:38209450-38209472 TTAGCCACATTTCAACATCTTGG - Intergenic
1082186819 11:49192527-49192549 TTTGACAAATGCCAACATCTGGG - Intronic
1083693499 11:64426599-64426621 AGAGACACATTTCACCATGTTGG + Intergenic
1084388115 11:68856842-68856864 ACAGACACATTCCACCATCGCGG + Intergenic
1085948072 11:81296551-81296573 TTAACCACATGCCACCATTTTGG - Intergenic
1089138074 11:116265304-116265326 TTACCCACATTCCACCCTCTTGG - Intergenic
1090017435 11:123098675-123098697 ATAGGCACATGCCACCATCCTGG + Intronic
1091985177 12:4905096-4905118 TGAGACAGATTTCACCATGTTGG + Intergenic
1094314284 12:29120869-29120891 TTTAACACATTGCACCATCATGG + Intergenic
1095492531 12:42749454-42749476 TTAGGCACATTCCAGCTACTGGG - Intergenic
1096770015 12:53929194-53929216 GAAGACCCATTTCACCATCTTGG - Intergenic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1099154714 12:79159833-79159855 TTAGATACATTCCAATTTCTCGG + Intronic
1099419577 12:82440034-82440056 TTAGTCACATTTGACCATGTCGG + Intronic
1101218024 12:102604763-102604785 AGAGACAGATTTCACCATCTTGG - Intergenic
1101786586 12:107889198-107889220 ATATACACATTCCACCAAATTGG - Intergenic
1106693716 13:32147140-32147162 TGAGACACATTGCATCACCTGGG - Intronic
1110061674 13:71047896-71047918 TTAGTAACATTCCACAATTTTGG - Intergenic
1111090982 13:83446778-83446800 TTAGACATATTCCACACACTGGG - Intergenic
1111475087 13:88735445-88735467 TTAAACAAAGTCCACCATGTTGG + Intergenic
1114719130 14:24861613-24861635 TTATAAACATTCAGCCATCTTGG - Intronic
1114920278 14:27317761-27317783 CCAGGCACATTCCACCACCTTGG - Intergenic
1115303656 14:31913142-31913164 TGAGCCACATTCCAGCAGCTTGG + Intergenic
1115388468 14:32825606-32825628 TTAGAGACATATCATCATCTTGG - Intronic
1117113633 14:52486423-52486445 ACAGGCACATACCACCATCTTGG + Intronic
1122016223 14:98799079-98799101 GCAGAGACATTTCACCATCTTGG - Intergenic
1129729396 15:77921272-77921294 TTAGGCTCACTCCTCCATCTGGG + Intergenic
1129839120 15:78732698-78732720 TTAGGCTCACTCCTCCATCTGGG - Intergenic
1131072419 15:89474587-89474609 TTAAAAACATGCCACAATCTGGG - Intronic
1132433267 15:101777448-101777470 TTAGGCTCACTCCTCCATCTAGG + Intergenic
1137946973 16:52742784-52742806 TTGGACACATTCTACCCTTTTGG + Intergenic
1143086617 17:4420932-4420954 CTGCACACTTTCCACCATCTAGG + Intergenic
1144142543 17:12363540-12363562 GTAGAGACATTTCACCATTTTGG + Intergenic
1147588464 17:41666417-41666439 TTAGCAACCTTCCACCATCCAGG + Intergenic
1147737734 17:42651325-42651347 ACAGACACATACCACCATATTGG - Intergenic
1149784824 17:59425888-59425910 TTAGACACATGCTGTCATCTGGG - Intergenic
1151064394 17:71133811-71133833 TCAGACCCATTCCTCCATCAGGG + Intergenic
1152912479 17:83013268-83013290 TGAGACACAGGCCACCTTCTCGG - Intronic
1153729082 18:7989351-7989373 TTAGCCCCAAACCACCATCTTGG + Intronic
1156383660 18:36586672-36586694 AGAGACAGATTCCACCATGTTGG + Intronic
1158315669 18:56209229-56209251 TTTGTCACATTCCTCCATTTTGG - Intergenic
1159419091 18:68192513-68192535 TTAGACTAATACCACAATCTGGG - Intergenic
1165430747 19:35770689-35770711 GTAGAGACATTTCACCATGTTGG - Intronic
1166138093 19:40789685-40789707 GTAGAGACATTTCACCATGTTGG + Intronic
1168577304 19:57523472-57523494 ATAGCTACATACCACCATCTTGG - Intergenic
927887068 2:26725147-26725169 GCAGACACATACCACCATCAGGG - Intronic
928107846 2:28483728-28483750 TCTGACACATTCCACCTGCTAGG - Intronic
929047396 2:37803387-37803409 TTAGCCACATAACACCATTTTGG - Intergenic
931324185 2:61201399-61201421 GTAGAGACATTTCACCATGTTGG + Intronic
931912525 2:66917131-66917153 GTAGAGACATTTCACCATGTTGG - Intergenic
938462465 2:131506793-131506815 TTAGCCACCTTCCACTATGTGGG + Intergenic
942572671 2:177329620-177329642 TTATAGACATTCCACCCTCCAGG + Intronic
945315300 2:208364276-208364298 TATGACACATTCCACATTCTTGG - Intronic
946151033 2:217770820-217770842 TTAGACACCTTCCATCATGGAGG + Intergenic
946463218 2:219888785-219888807 TTAAACATATTCCAGCATCCTGG + Intergenic
1169836742 20:9888628-9888650 GTAGAGACATTTCACCATGTTGG - Intergenic
1170508974 20:17057679-17057701 TTAGACACAATCCACCCTACAGG + Intergenic
1175107136 20:56623673-56623695 GTAGAGACATTTCACCATGTTGG + Intergenic
950997031 3:17512654-17512676 TAATACACCTTCCACGATCTGGG + Intronic
952363769 3:32656734-32656756 ATAGACAGATTCCTCCATATAGG - Intergenic
952552462 3:34494956-34494978 TGAGACACAGTCCACCTTCTGGG + Intergenic
957324221 3:78671831-78671853 TTAGAAACAATCCAATATCTGGG + Intronic
962288222 3:134106412-134106434 TTAGACAGATGCCACCAGGTGGG + Intronic
963938511 3:151078141-151078163 TCTGACACATTTCTCCATCTTGG + Intergenic
969260658 4:6031244-6031266 GTAGAGACATTTCACCATGTTGG - Intronic
970244598 4:14046668-14046690 ATAGACACATTCCAGCAACAGGG - Intergenic
973110543 4:46391414-46391436 TTAGAAAAACTGCACCATCTAGG - Intronic
973797181 4:54439589-54439611 TTAGACACACTCCTCCCTGTAGG - Intergenic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
975226194 4:71875813-71875835 TTAGAGATATTCCACCACCATGG + Intergenic
975972172 4:80052929-80052951 TTGGAAACAATCCATCATCTGGG + Intronic
976342449 4:83960393-83960415 TTGGACACTTCCCATCATCTTGG + Intergenic
977750282 4:100601794-100601816 TTAGACAGAATCCACCATTCTGG + Intronic
978450030 4:108822371-108822393 TTAGACTCATACAACCAACTAGG + Intronic
979023402 4:115533432-115533454 GTAGAGACATTTCACCATGTTGG + Intergenic
979663711 4:123287851-123287873 TTACACAAATGCCACCTTCTCGG - Intronic
980574899 4:134672855-134672877 TTAGAGACATTTCACATTCTTGG - Intergenic
982418092 4:155160893-155160915 TTAGCCACATTTCAGCAGCTAGG - Intergenic
984840085 4:184060212-184060234 TCAGCCCCACTCCACCATCTCGG + Intergenic
986150270 5:5121899-5121921 GTAGACCCATTCCATCATCCAGG + Intergenic
988093474 5:26570379-26570401 TTAGACATATTCCACCTCCAAGG - Intergenic
988164800 5:27573297-27573319 GAAGAAACATTCCACAATCTTGG + Intergenic
988988491 5:36645509-36645531 ATAGACAGGTTTCACCATCTTGG + Intronic
989669313 5:43896348-43896370 TTACTCAGATTCCACGATCTGGG + Intergenic
991361752 5:65828079-65828101 TTAGACACATTCCATTACCCAGG + Exonic
994660656 5:102649987-102650009 TCATACACATTCCTCCATTTTGG + Intergenic
995055072 5:107750182-107750204 TTAGACATATAGCACCTTCTAGG + Intergenic
1000753563 5:165128294-165128316 TTAGAACCATTACTCCATCTTGG - Intergenic
1004646701 6:17569194-17569216 TTAGAGACTTTTCACCATGTTGG - Intergenic
1004754682 6:18599174-18599196 TTAGACACATTGCCCAGTCTAGG - Intergenic
1005297807 6:24443858-24443880 TTAGACAGGTTTCACCATGTTGG + Intronic
1005417639 6:25618812-25618834 TATGACACATTCAACCATTTTGG - Intronic
1005934715 6:30511970-30511992 TGAGACAGATTTCACCATGTTGG - Intergenic
1014321561 6:119936048-119936070 TTAGACACTTACCAACATTTTGG - Intergenic
1014658564 6:124137299-124137321 GTAGACAGATTTCACCTTCTTGG - Intronic
1018133872 6:160759034-160759056 TTAGAGACTTTTGACCATCTTGG - Intergenic
1019362829 7:614296-614318 TTAGCCGTGTTCCACCATCTTGG - Intronic
1020239382 7:6381052-6381074 TGAGACAGGTTTCACCATCTTGG + Intronic
1023706309 7:42945380-42945402 TCAGTCACACTCCACCACCTGGG - Intronic
1024588201 7:50859095-50859117 TTGGACACCTTCCACCATGGAGG + Intergenic
1024657249 7:51461458-51461480 AGAGACAGATTTCACCATCTTGG - Intergenic
1032120719 7:129153797-129153819 ACAGACACATGCCACCAACTGGG - Intronic
1033971745 7:147049552-147049574 TTAGACACAGCCCCCCATTTTGG + Intronic
1043685895 8:83085826-83085848 TCAGACACCTTCCAAGATCTGGG + Intergenic
1051009420 9:12393208-12393230 TTAGAAACAATCCAGAATCTTGG + Intergenic
1051417428 9:16856856-16856878 TAATACACATTTCACCATCTAGG - Intronic
1052230904 9:26151487-26151509 TCAAATACATTCTACCATCTTGG - Intergenic
1052766529 9:32646956-32646978 TTAAAGACATTCCACAATTTGGG - Intergenic
1056316168 9:85392511-85392533 TTGGACACATTCCACGTTGTGGG - Intergenic
1057059706 9:91992748-91992770 TGACACCCATTACACCATCTGGG - Intergenic
1059885776 9:118743257-118743279 CTGGACACATTCAACCATGTTGG + Intergenic
1061063865 9:128265521-128265543 TTAGGCTCACTCCTCCATCTGGG + Intronic
1061826652 9:133262075-133262097 TAAGACACATTTGACCATCGAGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1188521274 X:31040700-31040722 TTACACACTTACCAGCATCTGGG - Intergenic
1189435850 X:40991931-40991953 TGAGACACTTTCCAACTTCTGGG + Intergenic
1192181900 X:68921430-68921452 TTGGACAAATTCCACCAGGTGGG + Intergenic