ID: 1070415857

View in Genome Browser
Species Human (GRCh38)
Location 10:76188614-76188636
Sequence CATACAACTGAGAAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070415852_1070415857 14 Left 1070415852 10:76188577-76188599 CCATATTCACCTGATGGAATAAC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1070415857 10:76188614-76188636 CATACAACTGAGAAGATGGAGGG No data
1070415851_1070415857 15 Left 1070415851 10:76188576-76188598 CCCATATTCACCTGATGGAATAA 0: 1
1: 0
2: 2
3: 10
4: 128
Right 1070415857 10:76188614-76188636 CATACAACTGAGAAGATGGAGGG No data
1070415853_1070415857 5 Left 1070415853 10:76188586-76188608 CCTGATGGAATAACACTTCCAAA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1070415857 10:76188614-76188636 CATACAACTGAGAAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070415857 Original CRISPR CATACAACTGAGAAGATGGA GGG Intronic
No off target data available for this crispr