ID: 1070415857 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:76188614-76188636 |
| Sequence | CATACAACTGAGAAGATGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1070415852_1070415857 | 14 | Left | 1070415852 | 10:76188577-76188599 | CCATATTCACCTGATGGAATAAC | 0: 1 1: 0 2: 0 3: 7 4: 93 |
||
| Right | 1070415857 | 10:76188614-76188636 | CATACAACTGAGAAGATGGAGGG | No data | ||||
| 1070415851_1070415857 | 15 | Left | 1070415851 | 10:76188576-76188598 | CCCATATTCACCTGATGGAATAA | 0: 1 1: 0 2: 2 3: 10 4: 128 |
||
| Right | 1070415857 | 10:76188614-76188636 | CATACAACTGAGAAGATGGAGGG | No data | ||||
| 1070415853_1070415857 | 5 | Left | 1070415853 | 10:76188586-76188608 | CCTGATGGAATAACACTTCCAAA | 0: 1 1: 0 2: 1 3: 12 4: 152 |
||
| Right | 1070415857 | 10:76188614-76188636 | CATACAACTGAGAAGATGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1070415857 | Original CRISPR | CATACAACTGAGAAGATGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||