ID: 1070418074

View in Genome Browser
Species Human (GRCh38)
Location 10:76208738-76208760
Sequence CTGGATAGGCACAAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070418074_1070418080 3 Left 1070418074 10:76208738-76208760 CCCCTCTGCTTGTGCCTATCCAG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 1070418080 10:76208764-76208786 ACCAATCCCATATTTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070418074 Original CRISPR CTGGATAGGCACAAGCAGAG GGG (reversed) Intronic
901322626 1:8348953-8348975 CTGGACAGGCCTCAGCAGAGCGG - Intergenic
902337050 1:15759578-15759600 CTGGTTAGGCAGCAGCTGAGAGG - Intronic
903609264 1:24598161-24598183 CTGGAAGGGAAGAAGCAGAGAGG - Intronic
908117526 1:60954440-60954462 CTGGGGAGGCACAAGCAGTGGGG - Intronic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
909388920 1:75095211-75095233 CTGGATAGATAAAAGCACAGGGG + Intergenic
909542835 1:76809841-76809863 TTGGAGAGGAACAAGGAGAGAGG - Intergenic
913184221 1:116353746-116353768 ATTGACAGGCACAAACAGAGAGG - Intergenic
916510650 1:165469756-165469778 CGGGAAAGGCAAAAGCAGAGTGG - Intergenic
917855260 1:179094358-179094380 CTGGGTGGGCACAAGAAAAGTGG + Intronic
919413860 1:197281652-197281674 CTGGTAAGGAAGAAGCAGAGTGG + Intronic
920076697 1:203342359-203342381 CTGGCAAGGCGCAGGCAGAGGGG + Exonic
922284382 1:224156053-224156075 TTGGATACGGATAAGCAGAGAGG + Intronic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923270791 1:232353417-232353439 CTGGATGGCCACAAGCAAACGGG + Intergenic
1063142935 10:3271698-3271720 CTGGATGCTCATAAGCAGAGTGG - Intergenic
1064967477 10:21029818-21029840 CTGGATAGGCAGTGGCAGAAGGG + Intronic
1065047134 10:21754599-21754621 CTGGAGAGGGACAGGGAGAGGGG - Intergenic
1070418074 10:76208738-76208760 CTGGATAGGCACAAGCAGAGGGG - Intronic
1070788479 10:79175923-79175945 CTGGATGGGAAAAGGCAGAGAGG + Intronic
1075687017 10:124371314-124371336 CTGGAGAGCCTCAAGCAGAAAGG - Intergenic
1076462145 10:130654925-130654947 CTAGAGAGGGACAAGCAGTGAGG + Intergenic
1076810815 10:132885547-132885569 CTGGGGAGGCCCAGGCAGAGGGG + Intronic
1078955137 11:16185283-16185305 TTGAATATCCACAAGCAGAGTGG - Intronic
1084898665 11:72293895-72293917 CTGGATATTCACACCCAGAGTGG - Intronic
1084946472 11:72641594-72641616 CTGGAGAGGAACAAGAGGAGGGG + Intronic
1085466097 11:76724273-76724295 CTGGGGAGCCACAAGCAGAAAGG + Intergenic
1086150074 11:83599369-83599391 CTGGATAAGCAAAAGCAAGGAGG - Intronic
1087239078 11:95755391-95755413 CTGGAGACCCAAAAGCAGAGTGG + Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090374269 11:126277839-126277861 CTGGGCAGGCACAGGCAGTGAGG + Exonic
1090612033 11:128480010-128480032 ATGGCTATTCACAAGCAGAGTGG + Intronic
1091908756 12:4211774-4211796 CTGCCTGGGCCCAAGCAGAGGGG + Intergenic
1092190055 12:6512639-6512661 CTGGGGAGCCACAAGCAGGGAGG + Intronic
1092237397 12:6818839-6818861 CTGGACAGCGCCAAGCAGAGCGG + Exonic
1096255320 12:50058671-50058693 CTGGATGGGCACATGTGGAGGGG + Intronic
1096845394 12:54403737-54403759 CTGGACTGGCAGAAGCAGAAGGG - Exonic
1096846097 12:54407921-54407943 GTGGATAGGCCAGAGCAGAGGGG - Intronic
1097168275 12:57097166-57097188 CAGGCTAGGCAAATGCAGAGTGG + Intronic
1099719508 12:86342426-86342448 CTGCATAGGCAGTGGCAGAGAGG - Intronic
1099728728 12:86469460-86469482 CTGGATAGGCACACACAGCAAGG + Intronic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1102298324 12:111754055-111754077 TTGGAAAGGCACAAGAAGAGAGG + Intronic
1104720850 12:131044399-131044421 CAGGAGAGGCAGAAGCACAGGGG + Intronic
1105424673 13:20284202-20284224 CTGGATAGGAAGGAGCAGAGGGG - Intergenic
1107040628 13:35943925-35943947 ATAGATAGAGACAAGCAGAGAGG - Intronic
1107813324 13:44220584-44220606 CAGGGTAGGCATAAGAAGAGAGG - Intergenic
1107869885 13:44736556-44736578 CTGGGGAGCCACAAGGAGAGGGG + Intergenic
1108516611 13:51209267-51209289 TTGGAGAGGCACAATTAGAGTGG + Intergenic
1109982957 13:69934697-69934719 GTGGAGAGGGACAAGAAGAGAGG - Intronic
1111323887 13:86665808-86665830 TTGGAAGGGCACAAGCAGAGGGG - Intergenic
1111826318 13:93272787-93272809 ATGGATAGGCACAGGCATAGAGG - Intronic
1113557112 13:111246339-111246361 CTAAATAGGCACAAGCTGAAGGG - Intronic
1114278707 14:21170278-21170300 CTGCAGAGGCACTGGCAGAGGGG - Intergenic
1115655289 14:35438063-35438085 CTGGATAGGGCCAGGCACAGTGG - Intergenic
1117224039 14:53636943-53636965 CTAGATGGGCACAAACACAGAGG + Intergenic
1121115137 14:91338118-91338140 CTCGATAGGCACGAGCAGACCGG + Exonic
1122060601 14:99134386-99134408 GTGCAAAGGCAGAAGCAGAGAGG + Intergenic
1125882642 15:43207677-43207699 CTGGACAGGCAGAAGCTCAGAGG + Intronic
1125964348 15:43861518-43861540 CTGGATAGGAACTAGCAAACTGG - Intronic
1127512115 15:59653122-59653144 CAGGATAGGTGCAAGCAGTGGGG + Intronic
1128706073 15:69838164-69838186 TTGGACAGGCAGGAGCAGAGAGG - Intergenic
1128812547 15:70583252-70583274 CTGGAAAGGCAGGAGCTGAGAGG + Intergenic
1129546498 15:76401466-76401488 CTGGAATGGCACAAGCCTAGAGG - Intronic
1129671558 15:77610656-77610678 CTGGGTTTGCCCAAGCAGAGAGG - Intergenic
1131493215 15:92880948-92880970 CTGTAAAGGCACAATCAGAGAGG + Intergenic
1133887418 16:9843648-9843670 CTGGGTTGACAGAAGCAGAGTGG - Intronic
1133915334 16:10104499-10104521 ATGGAAAGCCAGAAGCAGAGGGG - Intronic
1134743438 16:16569126-16569148 CTGGATAGTCATAAGCTGTGGGG - Intergenic
1134852737 16:17494695-17494717 CTGGAGAAGCACTAACAGAGGGG + Intergenic
1134924117 16:18143335-18143357 CTGGATAGTCATAAGCCGTGGGG + Intergenic
1135802253 16:25508265-25508287 CTGGATTGGGCCAATCAGAGTGG + Intergenic
1136296962 16:29309245-29309267 CTGAACTGGCACAGGCAGAGGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1140759474 16:78098359-78098381 CTGAAGAGGCACAGGAAGAGAGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141587236 16:85042480-85042502 CTAGATAAACCCAAGCAGAGGGG - Intronic
1142058514 16:88015349-88015371 CTGAACTGGCACAGGCAGAGGGG - Intronic
1142241827 16:88950879-88950901 CTGGATCGGCACCGGCACAGAGG + Exonic
1142241891 16:88951147-88951169 CTGGATCGGCACCGGCACAGAGG + Exonic
1142241922 16:88951281-88951303 CTGGACTGGCACCAGCACAGAGG + Exonic
1144714839 17:17426762-17426784 CTGGATAGGGAGGAGCAGAGGGG - Intergenic
1146694416 17:34897895-34897917 CTGGAAAGGCTCAAGCCCAGTGG - Intergenic
1147550886 17:41440681-41440703 CTGGCAAGGGACAAGCAGTGTGG + Exonic
1148897107 17:50845410-50845432 CTGGATCAGCACAAACACAGAGG - Intergenic
1149525341 17:57351188-57351210 CTTGCAAGGCACAAGCAGGGAGG + Intronic
1150597631 17:66620372-66620394 CTGGGTAGGCAGAAGAAAAGGGG + Intronic
1151067468 17:71168197-71168219 CTGGATTGGCTTAATCAGAGGGG + Intergenic
1151569711 17:74920156-74920178 CTGGAGCGGCGCAAGCAGGGCGG - Exonic
1151849745 17:76683331-76683353 CTGGATTGGCACAGGCAGGTGGG + Intronic
1151959401 17:77397619-77397641 CAGGATAGGCACAAGCCCTGAGG - Intronic
1152784846 17:82242234-82242256 CTGCACAGGCACAAGGAGATAGG - Intronic
1153266342 18:3273726-3273748 CTTGATAGGCCAAAGCGGAGGGG + Intronic
1155790685 18:29966239-29966261 CTGGATTGGTACAAGAAAAGTGG - Intergenic
1155904589 18:31434323-31434345 CTGGACATCCACATGCAGAGAGG + Intergenic
1156916364 18:42467637-42467659 CTGTATAGGCACAGGAAGAAAGG - Intergenic
1159074478 18:63665046-63665068 ATAGATAGGCACAAGCACATAGG - Intronic
1159554016 18:69926191-69926213 TGGGATAGATACAAGCAGAGAGG - Intronic
1161733222 19:5974992-5975014 CTGGAAAGGCAGAAGCCAAGAGG + Intronic
1162382344 19:10339027-10339049 CTGTCTCGGCACAAGGAGAGAGG - Intronic
1165224654 19:34346074-34346096 CTAGATAGGCAAAATCAGTGCGG + Intronic
1165999617 19:39870639-39870661 GTGGGGAGGCACAGGCAGAGGGG + Intronic
926711927 2:15888836-15888858 CTGGCTGTGCCCAAGCAGAGTGG + Intergenic
928399697 2:30969020-30969042 TTGGAGAGGCCCAGGCAGAGGGG + Intronic
933144498 2:78834942-78834964 CAGGAAAGGCACAAGAAGATTGG + Intergenic
933760237 2:85667595-85667617 CTGGATGGGCAGGAGGAGAGTGG - Intronic
935070647 2:99690869-99690891 TGGGAAAGGCAGAAGCAGAGAGG + Intronic
935745645 2:106188279-106188301 CTGGATAGGAAAAAGAAGATAGG + Intronic
936059739 2:109286589-109286611 CTGGATTGGCACATGGTGAGGGG + Intronic
936798577 2:116237741-116237763 CAGAATACGCACAGGCAGAGCGG - Intergenic
938692205 2:133801999-133802021 CTGCAAAGACACAAGGAGAGGGG - Intergenic
943314418 2:186369408-186369430 CTGGAGAGGCCCAAGTGGAGAGG - Intergenic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
943826662 2:192403020-192403042 CTGGATAAGTTCAAGCAGGGAGG + Intergenic
949018085 2:241724852-241724874 CAGGAGAGGCACACGCAGTGGGG - Intronic
1170159095 20:13294659-13294681 TTGCAAAGGTACAAGCAGAGTGG + Intronic
1172978668 20:38925188-38925210 CTGGAAATGCCCAGGCAGAGGGG + Intergenic
1173238022 20:41266232-41266254 CTTCATAGGTAGAAGCAGAGTGG + Intronic
1173669273 20:44786424-44786446 CAGGATAGGGACTAGCAGAGAGG - Intronic
1175971210 20:62687620-62687642 CTGGAGAGGCCCACCCAGAGCGG - Intergenic
1178197609 21:30366439-30366461 CTGGCTAAGAAAAAGCAGAGTGG - Intronic
1178883182 21:36464627-36464649 CCTGATAGGCACAGCCAGAGGGG + Intronic
1180023803 21:45147004-45147026 CTGGCCAGGCCCAAGCACAGTGG - Intronic
1180658318 22:17443472-17443494 GTGGAAAGGCACCAGCAGGGAGG + Intronic
1180695688 22:17750175-17750197 CTGGAAAGGGACACACAGAGTGG + Intronic
1181435673 22:22909228-22909250 CAGGAAACGCAGAAGCAGAGAGG - Intergenic
1182149941 22:28020864-28020886 CTTGTTTGGCCCAAGCAGAGTGG - Intronic
1183101421 22:35586346-35586368 CAGCATAGGCACACTCAGAGAGG - Intergenic
1183214523 22:36470645-36470667 CCAGATAGGCACAAGCACAGTGG + Intronic
1183305543 22:37081160-37081182 CTGGGCAGGCACAAGCTGAGGGG - Intronic
1183544861 22:38450020-38450042 CTGCAGCGTCACAAGCAGAGGGG + Intronic
1183606908 22:38871508-38871530 CTGTATGGGCCCAAGAAGAGGGG - Exonic
1184608487 22:45587697-45587719 CTGGAGTGGCTGAAGCAGAGCGG - Intronic
1185217235 22:49608361-49608383 CTGATTTGGCCCAAGCAGAGTGG + Intronic
1185373917 22:50473527-50473549 TTGGATAGACATGAGCAGAGAGG + Intronic
951142038 3:19174012-19174034 CTGGAGAGGCAAAGTCAGAGTGG - Intronic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
953040292 3:39250306-39250328 CTGGCTAGTCACTAGCATAGTGG - Intergenic
956882472 3:73525098-73525120 CTGGGTAGGTACTAGCAGAAAGG + Intronic
957573744 3:81983122-81983144 CTGGTTTGGCACAAGCACAAAGG + Intergenic
961177204 3:124845434-124845456 CTGGGGAGGCACACGCAGCGTGG - Intronic
961493583 3:127274487-127274509 CTGGTGAGGCCCAACCAGAGTGG + Intergenic
961623848 3:128245502-128245524 CTGGACAGGGAGAAGCAGAGTGG + Intronic
963094394 3:141520334-141520356 AGGGATTGGCAGAAGCAGAGGGG + Intronic
963339541 3:144018251-144018273 CTGGCTGGGCCCAAGCAGTGGGG + Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964530001 3:157657270-157657292 CTGAATTGTCACAGGCAGAGAGG + Intronic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
967997950 3:195180690-195180712 CTGGACACACACAAGCAGACGGG + Intronic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
969328601 4:6459277-6459299 GTGGAGAGGCACATGCAGAGAGG - Intronic
969470274 4:7383494-7383516 CTGGCTGGGCACCAGCAGGGAGG + Intronic
969636425 4:8372027-8372049 ATGGATGGGCACACACAGAGTGG + Intronic
970574781 4:17416684-17416706 CTGTAGAGGCACTGGCAGAGTGG - Intergenic
970875330 4:20862479-20862501 CAGGAAAGGCAAAAGCTGAGAGG + Intronic
971552380 4:27974299-27974321 TGGGATTGGCACAATCAGAGAGG - Intergenic
973583789 4:52371263-52371285 CTGGATGGGGATAAGCAGATGGG - Intergenic
977819853 4:101458734-101458756 CTGCAGAGGCACTGGCAGAGAGG - Intronic
978257326 4:106708425-106708447 CTGCACAGAGACAAGCAGAGGGG - Intergenic
980135886 4:128858151-128858173 CTGGATATGCAAAAGCAGGCAGG - Intronic
987431927 5:17845194-17845216 CTGGATAGGCAGTGGCAGAGAGG + Intergenic
989056652 5:37372000-37372022 CAGGATAGGAGAAAGCAGAGAGG + Intergenic
990773132 5:59273273-59273295 GTGCAGAGGCACAAGAAGAGAGG + Intronic
993531321 5:89028417-89028439 CTGGAAATGCACCAGCAAAGGGG - Intergenic
994245011 5:97468612-97468634 CTGGATAGGGAGGAGCAGAGGGG + Intergenic
998127333 5:139633523-139633545 CTGCATGGGCACAACCTGAGAGG + Intergenic
999172305 5:149605969-149605991 CTGGAGAAGGACAAGCAGGGAGG + Intronic
999323550 5:150629319-150629341 GAGAATAGGCACAAGCACAGCGG + Intronic
1000464136 5:161554288-161554310 CAGGATAGGTTGAAGCAGAGGGG + Intronic
1001565211 5:172695684-172695706 CTGGGAAGGCCCAAGCTGAGAGG - Intergenic
1005757961 6:28942394-28942416 CTGGAAAGGCAAAAGAAGATAGG - Intergenic
1006322718 6:33329737-33329759 GCGGGTAGGAACAAGCAGAGGGG + Intergenic
1009921893 6:70072570-70072592 AAGGACAGGCACAGGCAGAGAGG - Intronic
1010648016 6:78416920-78416942 CTGTATAGGCAAGAGCAGACTGG + Intergenic
1013499250 6:110731370-110731392 CTGGATAGGCAAATCCATAGAGG + Intronic
1015589837 6:134812588-134812610 GTGGAAAGGCAGAACCAGAGGGG - Intergenic
1017898098 6:158698949-158698971 CTCCACAGGCACCAGCAGAGAGG + Intronic
1017918873 6:158854611-158854633 CTGCTTAGGCACAAACAGAAAGG + Intergenic
1018865947 6:167747235-167747257 CTGGATAGGCACAGGGACTGCGG + Intergenic
1022597713 7:31728472-31728494 CAGCATAGGCAAAAACAGAGGGG - Intergenic
1022640097 7:32173951-32173973 CTTGATAGACACAAGCAGTTTGG - Intronic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1030401628 7:109059067-109059089 CTGCATGTGCACCAGCAGAGAGG + Intergenic
1033075440 7:138245841-138245863 CTGGATAGGCAAATACATAGAGG + Intergenic
1033633239 7:143182040-143182062 ATGGGTAGAAACAAGCAGAGAGG + Intergenic
1034252957 7:149706802-149706824 CTGGCTAGGCACTAGGAGTGCGG - Intergenic
1035727241 8:1832121-1832143 TTCGACAGGCACCAGCAGAGCGG - Intronic
1036408676 8:8478637-8478659 CTGGAAAGGAACAGGAAGAGAGG + Intergenic
1036949352 8:13126148-13126170 CTGGATCCGCACAAGCCTAGAGG - Intronic
1038137368 8:24802273-24802295 CTGCATAGGCATTAGCTGAGAGG - Intergenic
1038200038 8:25403467-25403489 CTGGTTAGCCACAAGCAAACAGG + Intronic
1038924694 8:32125615-32125637 CAAGATAGGTAGAAGCAGAGAGG - Intronic
1045895211 8:107208263-107208285 CTAGACAGACACAAGCAGGGCGG + Intergenic
1046885099 8:119358038-119358060 CTGGAAAGTCACTAGCAGAGTGG - Intergenic
1047992669 8:130302645-130302667 CTGGAGAGACACCAGCTGAGGGG + Intronic
1051191169 9:14515162-14515184 CTGGACAGGTACAAGCATAAGGG + Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054988336 9:71289578-71289600 CTAGATAGGGTCAAGCACAGTGG + Intronic
1056803021 9:89707171-89707193 ATGGTGAGGCACAAGCACAGAGG + Intergenic
1060260926 9:122072858-122072880 CCGGATAGTAATAAGCAGAGAGG + Intronic
1061196963 9:129111730-129111752 CTGGAGGGGCAAAAGCTGAGGGG + Intronic
1062075955 9:134590103-134590125 CCGGCCAGGCAAAAGCAGAGGGG + Intergenic
1062215371 9:135386199-135386221 CTGGTTTGGGACAAGAAGAGTGG + Intergenic
1062274204 9:135723111-135723133 CTGGGGAGGCACAGGCAGTGTGG - Intronic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1192254335 X:69443018-69443040 CTGGAAAGGCAGTGGCAGAGAGG + Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193574756 X:83184050-83184072 CTGGATAGGGAGGAGCAAAGGGG + Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1198853789 X:140994935-140994957 CAGGATATGCAAAGGCAGAGAGG - Intergenic