ID: 1070427487

View in Genome Browser
Species Human (GRCh38)
Location 10:76303838-76303860
Sequence CGTGTTAGCCGCTGCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070427487_1070427489 -1 Left 1070427487 10:76303838-76303860 CCTGCCAGGCAGCGGCTAACACG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1070427489 10:76303860-76303882 GCTCGCTTTCATCTGCAGCTCGG No data
1070427487_1070427491 27 Left 1070427487 10:76303838-76303860 CCTGCCAGGCAGCGGCTAACACG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1070427491 10:76303888-76303910 ACTCTATTTGCATCCTAAATAGG No data
1070427487_1070427490 0 Left 1070427487 10:76303838-76303860 CCTGCCAGGCAGCGGCTAACACG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1070427490 10:76303861-76303883 CTCGCTTTCATCTGCAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070427487 Original CRISPR CGTGTTAGCCGCTGCCTGGC AGG (reversed) Intronic
900209102 1:1444805-1444827 CGTGGTACCCACTGCCTGGCTGG + Intergenic
900218939 1:1496723-1496745 CGTGGTACCCACTGCCTGGCTGG + Intronic
901768626 1:11519403-11519425 CGTGTTTGCCGCTCCCGAGCAGG + Exonic
905033804 1:34904557-34904579 AGTGATAGCGGCTTCCTGGCGGG - Exonic
919833805 1:201560092-201560114 TGTGTTTGCCTCTGCCTTGCTGG + Intergenic
922924792 1:229339633-229339655 CCTGTGGGCTGCTGCCTGGCTGG - Intronic
1070427487 10:76303838-76303860 CGTGTTAGCCGCTGCCTGGCAGG - Intronic
1071140814 10:82507364-82507386 CATGTTAGGCCCTGCCTGGGAGG + Intronic
1075536350 10:123275328-123275350 CCTGGTAGCCGCTGCCCGGCCGG + Intergenic
1076444281 10:130501265-130501287 TGTGTGAGCTGCTGCCTGGAAGG + Intergenic
1077209397 11:1361742-1361764 GGTGTGAGCCCATGCCTGGCTGG + Intergenic
1082810686 11:57477187-57477209 CGGGTCAGCGGCTGCCTGGGGGG - Exonic
1083853841 11:65382431-65382453 CGCATTTGCCGCTGCGTGGCAGG + Intronic
1083876431 11:65526436-65526458 CCTGTTCCCTGCTGCCTGGCTGG + Intronic
1086107197 11:83158208-83158230 GGAGTGAGCAGCTGCCTGGCTGG - Intronic
1104280695 12:127373979-127374001 CTGTTTAGGCGCTGCCTGGCTGG + Intergenic
1104901405 12:132191224-132191246 CTGGTGAGCCGGTGCCTGGCAGG + Intergenic
1104944753 12:132410581-132410603 CGTGTCTGCCGCTCCCAGGCTGG + Intergenic
1113905989 13:113819457-113819479 CATCTTTGCCTCTGCCTGGCTGG - Intergenic
1117943865 14:60997429-60997451 GATGTGAGCCACTGCCTGGCTGG + Intronic
1118765155 14:68904591-68904613 CTTCTTAGCCGCTGAGTGGCAGG + Intronic
1122124128 14:99570103-99570125 CGTGGATGCCCCTGCCTGGCAGG - Intronic
1136290280 16:29267485-29267507 CATGTCAGACGCTGCCTGGCAGG + Intergenic
1142096166 16:88241006-88241028 CATGTCAGACGCTGCCTGGCAGG + Intergenic
1151247296 17:72804741-72804763 GGTGTGAGCCACTGCGTGGCCGG - Intronic
1152855108 17:82661142-82661164 CGTGGTGGCTGCTGACTGGCGGG - Intronic
1157578177 18:48757970-48757992 TGTGTTTGGCACTGCCTGGCTGG - Exonic
1157677807 18:49580091-49580113 GGTGTGAGCCACTGCCCGGCTGG + Intronic
1160556724 18:79730346-79730368 CGTGTCAGCAGCTTCCAGGCAGG - Intronic
1162111572 19:8402599-8402621 CGTGTTCCACCCTGCCTGGCTGG - Intronic
1164602037 19:29568653-29568675 AATGTTGGCCGCTGCCTGGAGGG - Intergenic
1166290625 19:41860912-41860934 AGTGTTTGCCGGTCCCTGGCAGG + Intronic
947792502 2:232876199-232876221 CCTGCTAGCCCCCGCCTGGCCGG - Intronic
1179955987 21:44738892-44738914 CCTGCTAACAGCTGCCTGGCTGG - Intergenic
1181513063 22:23397433-23397455 CGTGTTAGGAGTAGCCTGGCTGG + Intergenic
1184732847 22:46380464-46380486 AGTGTTGGCCGCTGCATGTCGGG + Intronic
950668161 3:14509624-14509646 AGTGTCAGCCCCTGCCTGCCAGG - Intronic
952954796 3:38550305-38550327 CGTGTGAGCCTCGGCCTGGCTGG - Exonic
953356892 3:42263743-42263765 CGTGCTTGCGGCGGCCTGGCGGG - Intronic
953982124 3:47418194-47418216 CTGGTGAGCTGCTGCCTGGCAGG - Exonic
963107552 3:141659953-141659975 CGTGTTAGCGGCTCCAGGGCTGG + Intergenic
963326295 3:143866867-143866889 CTTGTTAGCAAGTGCCTGGCGGG - Intergenic
963759032 3:149267526-149267548 CGTGTGACCCACTGCCTGCCAGG - Intergenic
968879222 4:3290658-3290680 CCGCTGAGCCGCTGCCTGGCAGG + Intergenic
969323308 4:6426089-6426111 GCTGTTAGCCGCTGCCTTGCAGG - Intronic
972386788 4:38574691-38574713 AGTTTTAGCAGCTGCCTGGCGGG + Intergenic
979674573 4:123397885-123397907 CGCGGCAGCCTCTGCCTGGCAGG + Intronic
989171418 5:38473148-38473170 CGAGTCAGCCGCTGCCTTGCGGG - Intergenic
994768622 5:103953956-103953978 GGTGTTAGCCGCCTCCCGGCAGG - Intergenic
1002094034 5:176820516-176820538 TATGTTATCCGGTGCCTGGCTGG + Intronic
1002123858 5:177026701-177026723 TGTGTTAGCCTCTTCCTTGCAGG - Intronic
1002307274 5:178291235-178291257 CGTGCTGGCCGCTGACTGCCGGG - Intronic
1002634247 5:180599265-180599287 CGTGTTAGCTGGTGCATGGGTGG + Intergenic
1013116963 6:107110882-107110904 GGTGTGAGCCACTGCCTGACCGG - Intronic
1017526435 6:155245217-155245239 CGTGTAAGCCGCAGTGTGGCAGG + Intronic
1018754614 6:166838142-166838164 AATGTTAGCCGCTGACCGGCTGG - Intronic
1020275649 7:6622976-6622998 CGTGATCGGGGCTGCCTGGCCGG + Exonic
1035306223 7:157934164-157934186 CTTGTTAAGCGCTGCCTGCCTGG + Intronic
1036702125 8:11019729-11019751 CGTGTTAGCCTCTGCCTCTGAGG - Intronic
1040807582 8:51410379-51410401 CATGTTAGCCAGTCCCTGGCTGG + Intronic
1049419096 8:142509086-142509108 GCTGTGAGCCGCTGGCTGGCGGG - Intronic
1049674261 8:143882819-143882841 TGGGTGTGCCGCTGCCTGGCCGG + Intergenic
1049767953 8:144363781-144363803 CGTGGTGGCCACGGCCTGGCTGG - Intergenic
1051367221 9:16329703-16329725 AGAGTTGGCCGCTGCCTGGGTGG - Intergenic
1062209327 9:135355178-135355200 GGTGTGAGCCGCTGCCTGTGTGG - Intergenic