ID: 1070427488

View in Genome Browser
Species Human (GRCh38)
Location 10:76303842-76303864
Sequence CGAGCGTGTTAGCCGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070427488_1070427489 -5 Left 1070427488 10:76303842-76303864 CCAGGCAGCGGCTAACACGCTCG No data
Right 1070427489 10:76303860-76303882 GCTCGCTTTCATCTGCAGCTCGG No data
1070427488_1070427490 -4 Left 1070427488 10:76303842-76303864 CCAGGCAGCGGCTAACACGCTCG No data
Right 1070427490 10:76303861-76303883 CTCGCTTTCATCTGCAGCTCGGG No data
1070427488_1070427491 23 Left 1070427488 10:76303842-76303864 CCAGGCAGCGGCTAACACGCTCG No data
Right 1070427491 10:76303888-76303910 ACTCTATTTGCATCCTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070427488 Original CRISPR CGAGCGTGTTAGCCGCTGCC TGG (reversed) Intronic