ID: 1070427488

View in Genome Browser
Species Human (GRCh38)
Location 10:76303842-76303864
Sequence CGAGCGTGTTAGCCGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070427488_1070427490 -4 Left 1070427488 10:76303842-76303864 CCAGGCAGCGGCTAACACGCTCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1070427490 10:76303861-76303883 CTCGCTTTCATCTGCAGCTCGGG No data
1070427488_1070427489 -5 Left 1070427488 10:76303842-76303864 CCAGGCAGCGGCTAACACGCTCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1070427489 10:76303860-76303882 GCTCGCTTTCATCTGCAGCTCGG No data
1070427488_1070427491 23 Left 1070427488 10:76303842-76303864 CCAGGCAGCGGCTAACACGCTCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1070427491 10:76303888-76303910 ACTCTATTTGCATCCTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070427488 Original CRISPR CGAGCGTGTTAGCCGCTGCC TGG (reversed) Intronic
900209101 1:1444801-1444823 AGAGCGTGGTACCCACTGCCTGG + Intergenic
900218938 1:1496719-1496741 AGAGCGTGGTACCCACTGCCTGG + Intronic
924614173 1:245599013-245599035 CGTGCCTGTTAACAGCTGCCTGG + Intronic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1075536348 10:123275324-123275346 TGTGCCTGGTAGCCGCTGCCCGG + Intergenic
1078527497 11:12111440-12111462 ACAGCGTCTAAGCCGCTGCCGGG + Intronic
1087912847 11:103773725-103773747 CGAGCGTGGTGGCCGGTGCCTGG - Intergenic
1124439355 15:29675269-29675291 TGAGCGTGGCAGCTGCTGCCGGG + Intergenic
1125834246 15:42736462-42736484 CGAGCGTGGAGGCCGCGGCCTGG - Exonic
1136072762 16:27798270-27798292 CGAACGTGTTCCCCTCTGCCAGG + Intronic
1142175499 16:88643269-88643291 GGAGCGCGTGAGCCTCTGCCTGG - Exonic
1143241168 17:5444456-5444478 GGAGAGTGTCCGCCGCTGCCTGG - Exonic
1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG + Intronic
1152542188 17:80982002-80982024 GGAGCGTGGGAGCCCCTGCCTGG + Intergenic
1160439048 18:78875150-78875172 CAAGCATGTCAGCTGCTGCCTGG - Intergenic
1160462495 18:79049514-79049536 CGAGCGTGGTAGCTCATGCCTGG - Intergenic
1160567684 18:79797686-79797708 TGAGCGTGTGTGCCCCTGCCAGG + Intergenic
1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG + Intronic
932773582 2:74514607-74514629 CGCCCGTGCCAGCCGCTGCCGGG - Exonic
937845629 2:126575889-126575911 AGAGCCTGTTTGCAGCTGCCAGG + Intergenic
940624683 2:156159026-156159048 TAAGCCTGTTAGCCTCTGCCTGG + Intergenic
942251260 2:174049357-174049379 AGAGCGTGTTAGGGGCTGGCTGG - Intergenic
947821918 2:233078177-233078199 CATGGGTGTTAGCTGCTGCCAGG + Intronic
1172123216 20:32610631-32610653 CGAGCGAGTGAGCGGGTGCCCGG + Intergenic
1177031715 21:15988472-15988494 TGTGTGTGTTAGCCTCTGCCTGG + Intergenic
998335240 5:141365765-141365787 CGAGCGTTGTCGCCGCTGTCGGG - Exonic
1010001732 6:70956039-70956061 CGAGCTGGTGAGCCGCTTCCTGG - Exonic
1019387179 7:763838-763860 GGAGGGTGTCAGCAGCTGCCAGG + Exonic
1021984747 7:26087556-26087578 GGAGTGTGCTAGGCGCTGCCAGG + Intergenic
1061082797 9:128382284-128382306 AGAGCTGGTTAGCAGCTGCCAGG + Intronic
1061540904 9:131277479-131277501 CGGGCGCGCTCGCCGCTGCCGGG + Intergenic
1062567335 9:137169054-137169076 CGAGCGTGTAAACCACGGCCAGG + Exonic
1187476303 X:19614113-19614135 CAAGTGTGTGAGCTGCTGCCAGG - Intronic
1199894210 X:152116370-152116392 GGAGCGTCTTAGGCCCTGCCAGG - Intergenic