ID: 1070427490

View in Genome Browser
Species Human (GRCh38)
Location 10:76303861-76303883
Sequence CTCGCTTTCATCTGCAGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070427487_1070427490 0 Left 1070427487 10:76303838-76303860 CCTGCCAGGCAGCGGCTAACACG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1070427490 10:76303861-76303883 CTCGCTTTCATCTGCAGCTCGGG No data
1070427488_1070427490 -4 Left 1070427488 10:76303842-76303864 CCAGGCAGCGGCTAACACGCTCG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1070427490 10:76303861-76303883 CTCGCTTTCATCTGCAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070427490 Original CRISPR CTCGCTTTCATCTGCAGCTC GGG Intronic
No off target data available for this crispr