ID: 1070429912

View in Genome Browser
Species Human (GRCh38)
Location 10:76327479-76327501
Sequence CTGGCCTAATATAAGTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070429912_1070429921 26 Left 1070429912 10:76327479-76327501 CCTACACACTTATATTAGGCCAG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1070429921 10:76327528-76327550 TAGAAAGGCCATAAGCTGTTGGG No data
1070429912_1070429913 -8 Left 1070429912 10:76327479-76327501 CCTACACACTTATATTAGGCCAG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1070429913 10:76327494-76327516 TAGGCCAGTGTTCCCTGTTCAGG No data
1070429912_1070429920 25 Left 1070429912 10:76327479-76327501 CCTACACACTTATATTAGGCCAG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1070429920 10:76327527-76327549 CTAGAAAGGCCATAAGCTGTTGG No data
1070429912_1070429918 11 Left 1070429912 10:76327479-76327501 CCTACACACTTATATTAGGCCAG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1070429918 10:76327513-76327535 CAGGGATTATCTTCCTAGAAAGG No data
1070429912_1070429914 -7 Left 1070429912 10:76327479-76327501 CCTACACACTTATATTAGGCCAG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1070429914 10:76327495-76327517 AGGCCAGTGTTCCCTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070429912 Original CRISPR CTGGCCTAATATAAGTGTGT AGG (reversed) Intronic
906843833 1:49168740-49168762 GTGAGCCAATATAAGTGTGTGGG - Intronic
906888379 1:49678227-49678249 CTTGCCAAATTTATGTGTGTAGG + Intronic
909708207 1:78612359-78612381 CTGGCCTATTATATCTGTTTTGG - Intergenic
911143476 1:94530724-94530746 CTTTCCTAATGTAAGTGTGGTGG - Intronic
913535690 1:119769854-119769876 CCTGTCTAATATGAGTGTGTAGG + Intergenic
917959553 1:180131460-180131482 CTGGGCTAAAATCAGAGTGTTGG - Intergenic
918204795 1:182299265-182299287 CTGCCCTCATATAAGGGTGATGG - Intergenic
921655851 1:217736281-217736303 CTGTCTCCATATAAGTGTGTAGG - Intronic
921906675 1:220502585-220502607 CTGGACTCCTATAAGTCTGTAGG + Intergenic
1063243579 10:4195317-4195339 CTGGCCAAATATAAGTGCTCAGG - Intergenic
1065524029 10:26599838-26599860 CTGTCCTAATAGAAGTATGTAGG - Intergenic
1066675020 10:37878609-37878631 CTGGCATAAGATAAATGTATAGG - Intergenic
1070429912 10:76327479-76327501 CTGGCCTAATATAAGTGTGTAGG - Intronic
1073778606 10:106813069-106813091 CTGGCCACAGATAAGTGAGTAGG + Intronic
1079082538 11:17424037-17424059 CTGGCCTATAATAAGTGCTTAGG + Intronic
1079642783 11:22828264-22828286 GTGGGCTAATCTCAGTGTGTAGG + Intronic
1080550099 11:33366983-33367005 CTAGTCTAATATAAGTGGGGAGG + Intergenic
1081126154 11:39325137-39325159 TTGGGCTACTAGAAGTGTGTTGG - Intergenic
1089481678 11:118810664-118810686 CTGGCCTAATCTAATTGCCTTGG - Intergenic
1093930045 12:24947048-24947070 CTGGCCTAACAAAAGGGTGGTGG - Intronic
1099069183 12:78024626-78024648 ATGGCCTAAAATAAGTGATTTGG - Intronic
1101744185 12:107525770-107525792 CTGGACAAAGATAAGTGTTTTGG - Intronic
1101936997 12:109066350-109066372 CAGGCCTAATAAAAGTTTGATGG - Intronic
1106781846 13:33066776-33066798 CAGGGCGAATACAAGTGTGTAGG - Intergenic
1110541840 13:76714575-76714597 CTGGCCCAATATAAGCATGAAGG - Intergenic
1112407557 13:99134672-99134694 ATGGACTAACATCAGTGTGTAGG - Intergenic
1114836619 14:26210650-26210672 GTGGCCTATGGTAAGTGTGTAGG - Intergenic
1114942152 14:27625876-27625898 CAAGACTAATATAAGTTTGTTGG + Intergenic
1115011603 14:28554490-28554512 CAAGCCTGATTTAAGTGTGTGGG - Intergenic
1118498835 14:66337112-66337134 CTTGTCTATTATTAGTGTGTAGG - Intergenic
1125731895 15:41897142-41897164 CGGGCCTAATACAAGAGTATTGG - Exonic
1126853551 15:52815168-52815190 CTGACTTAATATAACTCTGTAGG + Intergenic
1128857691 15:71033204-71033226 CTCGTCTAATATTGGTGTGTAGG - Intronic
1139447014 16:67004215-67004237 CTTGCCTTATGTAAGTGAGTAGG + Exonic
1140282899 16:73571600-73571622 CTGACCTAAATTATGTGTGTTGG - Intergenic
1141444171 16:84047473-84047495 CTGGCCTAAAATCAAGGTGTTGG - Intergenic
1151892697 17:76960041-76960063 CTGGGCTAAAATCAATGTGTCGG + Intergenic
1156121556 18:33848721-33848743 CTGGTCTAAAATCAATGTGTTGG - Intergenic
1156944038 18:42805295-42805317 CTGGCCAAATATAAGAGAATTGG + Intronic
1157492514 18:48134363-48134385 CTGTCCTAATAGAATGGTGTTGG - Intronic
1164563613 19:29310589-29310611 ATGGACTAATTTAAGTCTGTGGG - Intergenic
1166896375 19:46024300-46024322 ATGTCCTTATATAAGTTTGTAGG - Intergenic
1167012974 19:46821247-46821269 CAGGCCTAAAATAATTGTTTTGG - Intergenic
925234867 2:2269181-2269203 TTAGTCTAAAATAAGTGTGTGGG - Intronic
926164907 2:10515646-10515668 CTGGCCTGATCTAGGTCTGTTGG - Intergenic
928204522 2:29274499-29274521 CTGGTCTAATAGAAGAGTGGTGG + Intronic
935921560 2:108021305-108021327 CTCCCAAAATATAAGTGTGTAGG - Intergenic
937511367 2:122598935-122598957 CTAGCCTAATATAATTGGGATGG + Intergenic
939390157 2:141557934-141557956 CTGGCCAAAAACAACTGTGTAGG - Intronic
940274724 2:151927344-151927366 CTGGGCTAAGATAGGTATGTGGG + Intronic
940455228 2:153889599-153889621 CTGGCCAAATAAAAGTGCATCGG - Intronic
941658614 2:168171303-168171325 CTGGCATAACAGCAGTGTGTGGG - Intronic
942466836 2:176217406-176217428 CTGGGCTAAAATCAATGTGTTGG + Intergenic
1170835046 20:19876985-19877007 CTGGCCTAATCCAAATGGGTGGG - Intergenic
957718606 3:83966386-83966408 ATGGCGTATTATATGTGTGTTGG + Intergenic
962462985 3:135631700-135631722 CTGTCCTAATATGACTGGGTGGG - Intergenic
971975463 4:33680515-33680537 CTGGCTTAAGATAAGGGTCTGGG - Intergenic
972082832 4:35174505-35174527 CTTGGCTAAAATCAGTGTGTTGG - Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974502425 4:62724824-62724846 CTGGGCTAAAATAAACGTGTTGG + Intergenic
978426103 4:108584272-108584294 CTGGGCTAATATCAAGGTGTTGG + Intergenic
981288994 4:143052114-143052136 CTGGCCTAATAAAATTTGGTTGG - Intergenic
983862320 4:172722958-172722980 CTGGGCTAAAATGAGGGTGTTGG + Intronic
984128096 4:175837278-175837300 CTGGGCTAAAATTAGGGTGTAGG - Intronic
984540287 4:181029951-181029973 TTTGCCTTATAAAAGTGTGTTGG + Intergenic
988331449 5:29845881-29845903 CTAGCATAAAATAAGTGTTTGGG - Intergenic
988681255 5:33486336-33486358 ATAGGCTAATATAAGTGTTTAGG + Intergenic
989023076 5:37033019-37033041 CATGGCTAATATATGTGTGTAGG + Intronic
990283529 5:54276925-54276947 CTGGCCTAAAATCAAGGTGTTGG - Intronic
990850773 5:60201971-60201993 CTGGCATAATATAAGTCTTAAGG - Intronic
992563566 5:77975721-77975743 GTTGCATAATATAAGTTTGTTGG - Intergenic
995628043 5:114100760-114100782 CTGGCCTAATAAAATAGTTTAGG - Intergenic
997693677 5:135844934-135844956 CTGACTTAATATAAGTGAGTTGG + Intronic
1004125370 6:12867841-12867863 CTGGCCTATTGTCTGTGTGTGGG + Intronic
1006620169 6:35358342-35358364 CTGGGCTAAAATCAGTGTGTTGG - Intronic
1008593163 6:53013856-53013878 CTGGCTTAATATAAGGAGGTGGG + Exonic
1010187795 6:73163031-73163053 CTGGACTGAAATAAGTGGGTTGG + Intronic
1010392229 6:75350714-75350736 TTGGTTTAATAAAAGTGTGTAGG - Intronic
1010961363 6:82149488-82149510 CTGGCCTAATATAATGGGTTTGG - Intergenic
1016606281 6:145931917-145931939 ATGGCCTAATATAAATGTATTGG - Intronic
1017371184 6:153711015-153711037 CTGGTCTTTTAAAAGTGTGTGGG - Intergenic
1018394077 6:163363904-163363926 CTGGCCTCAACTTAGTGTGTGGG - Intergenic
1023486611 7:40694284-40694306 CTGCCCTAACATAACTGTGATGG + Intronic
1028557210 7:92136934-92136956 CTGGCTTAATAGAAGACTGTTGG - Intronic
1029509921 7:100987670-100987692 CTGGTCTTTTAGAAGTGTGTGGG + Intronic
1031639544 7:124144855-124144877 CTGGCCTAATAAAAATGAGTTGG + Intergenic
1037249187 8:16873096-16873118 CTTGCCTATTTTAGGTGTGTAGG + Intergenic
1038000771 8:23389728-23389750 CTTCCCTAATATGAGTATGTGGG + Intronic
1042899035 8:73703252-73703274 CTGGTCATATAAAAGTGTGTGGG + Intronic
1045860931 8:106814461-106814483 CTGGGCTAAAATCAGGGTGTTGG + Intergenic
1046881890 8:119318518-119318540 CTGGGTTAATATAAGGGTATAGG - Intergenic
1048147740 8:131862259-131862281 GTGGACTAATATAAGTGCTTTGG - Intergenic
1050884535 9:10747268-10747290 CTGGCCTAATATCAAAGTGTTGG - Intergenic
1053349999 9:37407504-37407526 CTGGTGACATATAAGTGTGTGGG + Intergenic
1057504487 9:95621474-95621496 CTGGCCTATTTTAATTGTTTTGG + Intergenic
1185761710 X:2693656-2693678 CTGGCCTGATCTCAGAGTGTTGG + Intronic
1194861455 X:99003516-99003538 CTGGGCTAAAATAAAGGTGTTGG - Intergenic
1195981940 X:110588305-110588327 CTGGCTTAATAAAAATGAGTAGG + Intergenic
1199226706 X:145384408-145384430 CTGGCCAAATAGAATTGTTTTGG + Intergenic