ID: 1070441221

View in Genome Browser
Species Human (GRCh38)
Location 10:76445446-76445468
Sequence CCGTGATGCCCTGCATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070441221_1070441223 7 Left 1070441221 10:76445446-76445468 CCTGCAGATGCAGGGCATCACGG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1070441223 10:76445476-76445498 TTTGTCTGTTACCTAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070441221 Original CRISPR CCGTGATGCCCTGCATCTGC AGG (reversed) Intronic
900565231 1:3328905-3328927 CCGTGAAGCCCAGCATCCACAGG + Intronic
901483764 1:9543601-9543623 TAGTGATGTCCTTCATCTGCTGG + Intronic
902224751 1:14989597-14989619 CTCTGATGCACAGCATCTGCAGG + Intronic
902255634 1:15187070-15187092 CTCTGATGTCCTGCAGCTGCTGG - Intronic
902409125 1:16202489-16202511 CGGGGATGCCCTGCAGCTTCAGG + Exonic
902830647 1:19010219-19010241 CAGTGATGCCCTGCCTGTTCTGG + Intergenic
904031517 1:27536304-27536326 AGGTGCTGCCCTGCCTCTGCAGG - Intronic
905168244 1:36096158-36096180 GCGCGAGGCCCTGCAGCTGCGGG + Exonic
907483210 1:54758822-54758844 CCCCGATGGCCTGCATCTCCTGG + Exonic
916040929 1:160960835-160960857 CAGGAATGGCCTGCATCTGCAGG - Intergenic
916238436 1:162614012-162614034 CCTGGGTGCCCTTCATCTGCTGG - Intergenic
920875215 1:209828320-209828342 CCGTGAAGCACTCCATCTCCCGG - Intronic
922515956 1:226208558-226208580 CAGTTATGCCCTGGCTCTGCTGG - Intergenic
923655230 1:235910045-235910067 CCGTGAGTCCCTTCATCTCCAGG - Intergenic
1063958335 10:11285239-11285261 CTGTGATCCCCAGCATCTGAGGG - Intronic
1069708912 10:70476838-70476860 CCGTGGATCCCAGCATCTGCTGG + Intergenic
1070441221 10:76445446-76445468 CCGTGATGCCCTGCATCTGCAGG - Intronic
1072734380 10:97869203-97869225 CCGTGATGCCCTGGAAGTGGAGG - Exonic
1075679368 10:124321534-124321556 AGGTGACGCCCTGCATCCGCCGG - Intergenic
1076994342 11:290852-290874 CACTGAGGCCCTGCAGCTGCAGG + Exonic
1076997892 11:307873-307895 CAGTGAGGTCCTGCAGCTGCTGG + Intronic
1077949583 11:6941593-6941615 CCTTGATGCTCCCCATCTGCAGG - Exonic
1084282676 11:68108800-68108822 CTGTGATTCTCTGTATCTGCCGG - Intronic
1085665937 11:78416516-78416538 CCTTGATGCACTGCAGCTGGAGG + Intronic
1085921624 11:80964367-80964389 CTGTGATTCTCTGTATCTGCTGG + Intergenic
1088451097 11:109982203-109982225 CCTTGATGTCCTGCAACTGAAGG + Intergenic
1088788825 11:113206071-113206093 TCTTGATGCCCCGGATCTGCAGG - Exonic
1090466787 11:126942141-126942163 CCATGAAGCCCTGCACCTGTTGG + Intronic
1091613718 12:2033275-2033297 CCATGATGCCCGCCCTCTGCAGG + Intronic
1093542000 12:20298664-20298686 CCCTGCTGCCCTGCTGCTGCTGG - Intergenic
1096266035 12:50123396-50123418 TCATGATGCACTGGATCTGCTGG - Intergenic
1096684198 12:53277101-53277123 CCGGGAAGCCCTGCAGCTTCTGG + Exonic
1099502668 12:83432719-83432741 CAGGGAAGCCCTGCAGCTGCAGG + Intergenic
1101346493 12:103890764-103890786 CTGTGTTGCCCTCCATCTCCAGG - Intergenic
1105456326 13:20544491-20544513 CCCTGATGTCCTGGAGCTGCGGG - Intergenic
1107990675 13:45816297-45816319 CCTTGAGGCCCTGTTTCTGCTGG + Intronic
1110336555 13:74338882-74338904 GCCTAATGCCCTGCAGCTGCTGG + Intergenic
1112610467 13:100950110-100950132 CCCTGATCCATTGCATCTGCTGG + Intergenic
1118351090 14:64972643-64972665 CCGTGGCACCCTGCATCTGCAGG + Intronic
1120571020 14:86116595-86116617 CTCTGATGCCATGCTTCTGCAGG - Intergenic
1122073232 14:99218936-99218958 CCCTGATTCCCTGCCTCTGTGGG - Intronic
1126798895 15:52282569-52282591 CTGTGCTGCCCTGCATCCACCGG - Intronic
1126861299 15:52885606-52885628 CCTTGATGCCCTGCAAATGAAGG + Intergenic
1127361367 15:58247537-58247559 GCCTAATGCCCTGCCTCTGCTGG - Intronic
1129152154 15:73696036-73696058 CCCTGTGGCCCTGCTTCTGCAGG + Intronic
1129368039 15:75069027-75069049 CCCTGCTGCCCAACATCTGCAGG + Intronic
1130868436 15:87951728-87951750 AGGTGATGCCCTGCTTCTGAAGG + Intronic
1133387058 16:5378302-5378324 CAGAGATGTCCTGCCTCTGCTGG + Intergenic
1138211482 16:55166778-55166800 CCAAAATGCCCTGCATTTGCAGG - Intergenic
1139752153 16:69115460-69115482 CCCTGCAGCCCTGCATCTGGGGG - Exonic
1140465119 16:75175138-75175160 ACCTGAAGCCTTGCATCTGCAGG - Intergenic
1141461157 16:84179549-84179571 CTGTGCTGCCCAGCATCTGGCGG + Exonic
1142149422 16:88506124-88506146 CCATGATGCCTGGCCTCTGCTGG - Intronic
1142739295 17:1921381-1921403 CCGTGCTGGCCTGCACCTGTGGG + Intergenic
1143136728 17:4716446-4716468 CCGTGAAGACCTGGATGTGCTGG + Exonic
1144597582 17:16583944-16583966 AAGTGAGGCCCTGCCTCTGCTGG - Intergenic
1147994729 17:44354443-44354465 CCGAGTGGCCCGGCATCTGCGGG + Exonic
1149530618 17:57392038-57392060 CCAGGCTGCTCTGCATCTGCAGG - Intronic
1149553953 17:57559863-57559885 TCATGAAGCCCTGCCTCTGCAGG - Intronic
1150626918 17:66847875-66847897 CCTTGGTGCTGTGCATCTGCTGG - Intronic
1154501333 18:14999328-14999350 CCGTGAGGCCGTGGAACTGCGGG + Intergenic
1156229153 18:35137232-35137254 CTGTGATGTCATGCATCTGCAGG - Intronic
1157573952 18:48731293-48731315 CAGTGATGCCCATCAGCTGCTGG - Intronic
1158615293 18:58981527-58981549 CCTTGATGCCATGCATCAGCTGG - Exonic
1160151858 18:76401578-76401600 CCGAAACGCCCTGCAGCTGCTGG + Intronic
1160705959 19:530456-530478 CAGTGATGCCCGGAATCAGCTGG + Intergenic
1160773320 19:843531-843553 CCGGGTTCCCCCGCATCTGCAGG - Exonic
1162805359 19:13135525-13135547 CCATGATCTCCTGGATCTGCAGG - Exonic
1164712284 19:30365656-30365678 CTGTGAGGCTCTGCTTCTGCGGG + Intronic
1165838709 19:38774195-38774217 CAGTGATTTCCTGCATCTCCTGG - Intergenic
1165902110 19:39173824-39173846 CCGGGCTGCCCTGCAGCTGGTGG + Exonic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166782213 19:45348682-45348704 CCATGATGCCCTGCAGATCCGGG + Exonic
925418726 2:3692974-3692996 CCCTGATGTCCTGCCTCTCCTGG + Intronic
925911385 2:8575623-8575645 CCGGGATGCCCTTTAGCTGCCGG - Intergenic
927176285 2:20411190-20411212 AAGTGATGCCCTGCATCTCAGGG - Intergenic
927868912 2:26611056-26611078 CCGTGAATCCCTGCATTTGCTGG + Intronic
932276599 2:70456400-70456422 CGGTGATGGCCTGCTTCTTCTGG + Exonic
936078880 2:109418846-109418868 CAGTGCTGCCCTGCATGGGCTGG + Intronic
936149867 2:110010208-110010230 CCTTGATGCCATGCGTCAGCTGG - Intergenic
936194810 2:110361161-110361183 CCTTGATGCCATGCGTCAGCTGG + Intergenic
937081670 2:119144778-119144800 CCCTGGTCCCCTGCAGCTGCTGG + Intergenic
937679345 2:124627086-124627108 CCCTGAGACCCAGCATCTGCGGG + Intronic
938236803 2:129712062-129712084 CCAGGGTGCACTGCATCTGCTGG - Intergenic
938500503 2:131829497-131829519 CCGTGAGGCCGTGGAACTGCGGG + Intergenic
946362603 2:219228467-219228489 CCTCGATGCTCTGCAGCTGCTGG + Exonic
947773540 2:232689754-232689776 CCGTGGTGTCCTGCTTCTTCAGG + Intergenic
1172331657 20:34079930-34079952 CAGCGATGCCCTTCACCTGCTGG - Exonic
1174671437 20:52311412-52311434 CCGCCCAGCCCTGCATCTGCAGG - Intergenic
1176428555 21:6562992-6563014 CCCTGGTGACCTGCATCTCCTGG + Intergenic
1179704045 21:43171308-43171330 CCCTGGTGACCTGCATCTCCTGG + Intronic
1180582881 22:16858177-16858199 CTTTGATGCCATGCATCAGCTGG + Intergenic
1181166248 22:20984780-20984802 CCGTCATGCCCAGCCTGTGCTGG - Intronic
1182427515 22:30282781-30282803 GCCTGGTGCCCAGCATCTGCAGG - Intergenic
1184649147 22:45911704-45911726 CAGTGATGCCCTGCATCCTAAGG - Intergenic
1185188661 22:49418723-49418745 CAGGGATGCGCTGCACCTGCTGG + Intronic
950863630 3:16171907-16171929 CACTGAAGCCCTGCCTCTGCTGG - Intergenic
953200040 3:40770389-40770411 CCTTGTTCCCCTGCTTCTGCAGG + Intergenic
953967695 3:47322658-47322680 CTTTGATGCTCTGCAGCTGCAGG - Exonic
959941465 3:112086111-112086133 CGGAGATGGTCTGCATCTGCAGG + Intergenic
962607033 3:137041068-137041090 AGGTGATGCCCTGAATCTTCTGG + Intergenic
966912679 3:184568353-184568375 CCGTCCTGCCATGTATCTGCAGG - Intronic
969324122 4:6431185-6431207 CCGTGTTTCCCTGCACCTGGAGG + Intronic
969655673 4:8496675-8496697 CAGTGACCGCCTGCATCTGCAGG - Intergenic
971093716 4:23374026-23374048 CCTTTAAGCCCTGCATATGCTGG - Intergenic
975291263 4:72680141-72680163 CAGTCATGCCCTTCAGCTGCAGG - Intergenic
975834465 4:78407701-78407723 AGGTGCTGCCCTTCATCTGCAGG - Exonic
985528260 5:418771-418793 TCATGAGGCCCTGCATCTTCTGG - Intronic
985884747 5:2668831-2668853 CCCAGAGGCCCTGCCTCTGCAGG + Intergenic
986096453 5:4559119-4559141 CTGTGAGGACCTGCATCTGCTGG + Intergenic
986433584 5:7705595-7705617 CCCCTCTGCCCTGCATCTGCAGG - Intronic
994400527 5:99274235-99274257 CCCGGAAGCCCTGCAGCTGCTGG + Intergenic
997869978 5:137498543-137498565 CCGCGATCGCCGGCATCTGCGGG + Exonic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
1001296832 5:170504366-170504388 CCCTGAGTCCCTGCATGTGCGGG + Intronic
1005910070 6:30301867-30301889 CCCTGCTGCCCTGCACCTCCCGG + Intergenic
1006614914 6:35319574-35319596 CCTTGATGCGCTGCCGCTGCCGG - Exonic
1008845445 6:55957580-55957602 CCGTGATGTCCTGCATATGTGGG + Intergenic
1010276447 6:73972994-73973016 CAGTCATGCCCTTCTTCTGCAGG - Intergenic
1018796721 6:167191623-167191645 CCTTGGTGCTCTCCATCTGCCGG + Intronic
1019171204 6:170134224-170134246 CCCTGATCCCCTGCATGTGATGG - Intergenic
1019525707 7:1479552-1479574 CCGTGATGCCCGGCACCTCGGGG + Exonic
1029475545 7:100781549-100781571 CAGTGATGCCCAGCAGCTGTGGG - Intronic
1036712685 8:11091712-11091734 CAGTGATGCCCTGCAGCCGTGGG + Intronic
1038703315 8:29871558-29871580 CCCTGATGTCTTGCCTCTGCAGG - Intergenic
1048251053 8:132867026-132867048 CCCTGCTGGCCTCCATCTGCTGG + Exonic
1051478783 9:17537656-17537678 CCTTGCTGCCCTCCATGTGCAGG - Intergenic
1052400289 9:27991512-27991534 CCTTGACGCCTAGCATCTGCCGG - Intronic
1052879316 9:33591106-33591128 CCATGAGGCTCTGCCTCTGCAGG - Intergenic
1053013237 9:34647265-34647287 CTGTAGAGCCCTGCATCTGCAGG + Intronic
1053461749 9:38276951-38276973 CAGAGCTGCCCTGCATCTGCAGG + Intergenic
1053496660 9:38553111-38553133 CCATGAGGCTCTGCCTCTGCAGG + Intronic
1056243508 9:84670852-84670874 CCGAGAGGCACTGCATTTGCAGG - Exonic
1057676574 9:97140671-97140693 CCATGAGGCTCTGCCTCTGCAGG + Intergenic
1061571157 9:131478154-131478176 CCGTGACACCCTGCAGCTTCCGG + Intronic
1062499193 9:136845071-136845093 CCGTGAGGCCGTGGAACTGCGGG - Exonic
1187614896 X:20982063-20982085 CCATGTTGCCCTGCTGCTGCTGG + Intergenic
1187688527 X:21840101-21840123 CCCTGCTGCACTGCAGCTGCTGG - Intronic
1189252756 X:39613918-39613940 CTGTGATGCTCTGCAGCCGCCGG + Intergenic
1190380628 X:49836948-49836970 CCGGGCTGCTCAGCATCTGCTGG + Intergenic
1195495380 X:105525885-105525907 CCATGGCACCCTGCATCTGCAGG + Intronic
1202270222 Y:23065064-23065086 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202295805 Y:23355618-23355640 CCGTGGTGGCATGCACCTGCAGG + Intergenic
1202423216 Y:24698809-24698831 CCGTGGTGGCATGCACCTGCAGG - Intergenic
1202447573 Y:24971277-24971299 CCGTGGTGGCATGCACCTGCAGG + Intergenic