ID: 1070443811

View in Genome Browser
Species Human (GRCh38)
Location 10:76474408-76474430
Sequence ACTCCTGATGATGTTCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070443811_1070443812 2 Left 1070443811 10:76474408-76474430 CCTCAAAGAACATCATCAGGAGT 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1070443812 10:76474433-76474455 GAAAAGATAACCTCTAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070443811 Original CRISPR ACTCCTGATGATGTTCTTTG AGG (reversed) Intronic
900868795 1:5287343-5287365 AGTGCTGATGATGATCATTGTGG - Intergenic
904323094 1:29709318-29709340 ACTCACGTTGATGTTATTTGTGG + Intergenic
904427077 1:30435192-30435214 TTTCTTGATGATGTCCTTTGAGG - Intergenic
909578121 1:77199262-77199284 ACTCTACATGATGTTCCTTGTGG - Intronic
910199704 1:84686636-84686658 GCTTATGTTGATGTTCTTTGGGG - Intronic
910326906 1:86019837-86019859 AATGCTAATGATGTTCTTTTAGG - Intronic
913445794 1:118949507-118949529 AGTCCTGGTGATTTACTTTGTGG + Intronic
915846014 1:159265872-159265894 ACTCATGATGATCTGCTTTCAGG - Intergenic
916125778 1:161569738-161569760 ACTTCTGATTATCTCCTTTGTGG + Intergenic
916135694 1:161651569-161651591 ACTTCTGATTATCTCCTTTGTGG + Intronic
916302985 1:163296281-163296303 ACTCCTGTTTATTGTCTTTGAGG + Intronic
917133742 1:171768112-171768134 AGTCCTGATGATGATCCCTGAGG - Intergenic
917195400 1:172459221-172459243 GTTCTTGATGGTGTTCTTTGTGG - Intronic
921266979 1:213428990-213429012 ACTGTTGATGATGTGCTTTCTGG + Intergenic
924634982 1:245777577-245777599 ACTTTTGATGAGGTTCTTTTGGG - Intronic
1063216034 10:3926427-3926449 ACTGTTGGTGTTGTTCTTTGTGG + Intergenic
1070443811 10:76474408-76474430 ACTCCTGATGATGTTCTTTGAGG - Intronic
1070558861 10:77550696-77550718 ACTTCTGAAGATGTGCTTCGAGG - Intronic
1074419025 10:113293051-113293073 GCTACTGATGATGTTGGTTGTGG + Intergenic
1074500833 10:114022705-114022727 TCTCTTGATGATTTTATTTGAGG - Intergenic
1077174677 11:1183451-1183473 ACTCCTGATGATGTTGTTGTAGG - Intronic
1077174894 11:1184570-1184592 ACTCCTGATGATGTTGTTGTAGG - Intronic
1077175463 11:1187888-1187910 ACTCCTGATGATGTTGTTGTAGG - Intronic
1077175621 11:1188782-1188804 ACTCCTGATGATGTTGTTGTAGG - Intronic
1077175851 11:1190081-1190103 ACTCCTGATGATGTTGTTGTAGG - Intronic
1077176215 11:1192103-1192125 ACTCCTGATGATGTTGTTGTAGG - Intronic
1079065174 11:17284661-17284683 TCTCCTGATTATTTTGTTTGAGG - Intronic
1080655630 11:34255946-34255968 ACTCCTGATCATTTCCTTTCGGG + Intronic
1085833960 11:79932538-79932560 CCTCGTGTTGATGTTCTATGAGG - Intergenic
1088804177 11:113336341-113336363 TTTCTTGATGATGTTCTTTGCGG + Intronic
1090154083 11:124419038-124419060 ACTCCTGATGTTCTACTATGTGG + Intergenic
1090483842 11:127093857-127093879 ACTACTGATGTTGTTTTTTAGGG + Intergenic
1090576005 11:128104469-128104491 ACTCCTTAGGATGATCTGTGAGG - Intergenic
1090817505 11:130312019-130312041 ACCCCCAATGATGTTTTTTGGGG - Intronic
1090912158 11:131130541-131130563 ACTCCTCATGATGTTCTTTAGGG - Intergenic
1091056877 11:132427831-132427853 ATTCTTGATGAGGTTCCTTGTGG - Intronic
1091356700 11:134943184-134943206 ACTCCTGGTGACGTTGTTGGTGG - Intergenic
1091631502 12:2164212-2164234 AATCCTGACTGTGTTCTTTGGGG + Intronic
1091856115 12:3741737-3741759 ACTCCTAATGCTGTTCCTTTAGG - Intronic
1093372060 12:18377216-18377238 ACACCTGATCTTGTTGTTTGAGG + Intronic
1094545655 12:31402265-31402287 ACTTGTAATGATGTGCTTTGGGG - Intronic
1094723064 12:33085129-33085151 ACTTCTGATGCTGCTCTTTTAGG - Intergenic
1098184957 12:67886641-67886663 ACTCCTCATGTTGTTCTTCATGG + Intergenic
1098948846 12:76618267-76618289 ACTTCACGTGATGTTCTTTGTGG - Intergenic
1105358041 13:19678011-19678033 AATTCAGTTGATGTTCTTTGAGG - Intronic
1107094098 13:36516061-36516083 ACAGCTCATGATGTTCTTTGGGG - Intergenic
1107094715 13:36523430-36523452 ATTCTTAATGATGTCCTTTGAGG + Intergenic
1107688732 13:42930784-42930806 ATTCATGATGTTGTCCTTTGGGG - Intronic
1108759177 13:53542211-53542233 ATTTCTGATCATGTTGTTTGCGG - Intergenic
1109005862 13:56874954-56874976 TCTCCTGAAGCTGTGCTTTGAGG - Intergenic
1111877463 13:93915057-93915079 CCTCCTGATGATGTTGTTAAAGG + Intronic
1115803757 14:37027441-37027463 AATACTGATGATGAGCTTTGAGG + Intronic
1116263805 14:42662610-42662632 ACTCCTGATGACTTTCTATTGGG + Intergenic
1119910963 14:78348865-78348887 ACTCCAGAGGCTGTCCTTTGTGG + Intronic
1120571981 14:86130030-86130052 ACTGCCGATGTTGATCTTTGTGG + Intergenic
1120923826 14:89778836-89778858 ACTCCTGACCATGGTCTCTGAGG + Intergenic
1121544538 14:94753797-94753819 ACACCTCATGAGGCTCTTTGTGG - Intergenic
1122048942 14:99042232-99042254 ATTCCTGATGATGTTCTTCAGGG - Intergenic
1122351516 14:101096567-101096589 AGTCCTGTTCATTTTCTTTGAGG + Intergenic
1123754988 15:23390650-23390672 ACTCCTAATGATGTACTTACTGG + Intergenic
1124432989 15:29622979-29623001 ACCACTGATGATGATGTTTGGGG - Intergenic
1125305151 15:38303805-38303827 ATTCCTGAAGATGCTCTGTGGGG + Intronic
1127341795 15:58053601-58053623 ACTCCTGATGATCTGATTTAAGG - Intronic
1127624289 15:60764990-60765012 ACACATGATGCTGTCCTTTGTGG - Intronic
1131901361 15:97091518-97091540 ACATACGATGATGTTCTTTGAGG + Intergenic
1135296000 16:21279705-21279727 ACTGCTGAAGTTGTGCTTTGTGG + Intronic
1136023049 16:27452166-27452188 ACTCCTCTTGATGTTCTCTCTGG - Intergenic
1137532215 16:49285326-49285348 ACTCACTATGATGTTATTTGAGG + Intergenic
1137625648 16:49906523-49906545 TCTCCTAAATATGTTCTTTGGGG - Intergenic
1137631421 16:49948647-49948669 TCTCCTGATGGTGGACTTTGGGG - Intergenic
1138715115 16:59012246-59012268 ATTCCTGATGAAGTCCCTTGTGG + Intergenic
1138966947 16:62095776-62095798 CCTCCTTATGAAGTCCTTTGTGG + Intergenic
1149440882 17:56672934-56672956 ACGCTTGATGCTGTTCTTAGGGG - Intergenic
1149980582 17:61308169-61308191 ACTCCTGGTGTTGTTGTTTATGG + Intronic
1150429832 17:65106116-65106138 ACTCCTGTTAATCTCCTTTGAGG + Intergenic
1152213642 17:79019287-79019309 GCCCCTAATGATGTCCTTTGAGG + Intergenic
1152306239 17:79522347-79522369 GCTCCTGAGGATGGTTTTTGAGG - Intergenic
1153750931 18:8229577-8229599 AATCATGATGATGTTATTTATGG - Intronic
1154230693 18:12553413-12553435 GCTACTGCTGATGTTCATTGAGG - Intronic
1154497969 18:14976120-14976142 ACTCCTGGTGACGTTGTTGGTGG + Intergenic
1154958649 18:21285608-21285630 CCTCCTCAAAATGTTCTTTGTGG + Intronic
1155262307 18:24055700-24055722 TCTGCTGATTATGTTCTGTGAGG + Intronic
1157481534 18:48058323-48058345 ACTTTTGATGATGCCCTTTGTGG + Intronic
1157716796 18:49893598-49893620 ACTCCTGATGTGCTGCTTTGAGG - Intronic
1158810315 18:61025876-61025898 ATTTCTGAAGATGTTGTTTGAGG + Intergenic
1159523698 18:69560141-69560163 CCTCATGAAGATGCTCTTTGAGG - Intronic
1161176569 19:2846207-2846229 ACACCTGGAGATGTCCTTTGTGG + Intronic
1165239193 19:34450530-34450552 ACTCCTGAAAATGTTATTAGTGG - Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1167340244 19:48911343-48911365 ATTCCTGCTGGTGTTCTCTGAGG + Intronic
927021568 2:19022386-19022408 AATCCAGGTGTTGTTCTTTGAGG + Intergenic
927109626 2:19855139-19855161 CAGCCTGAGGATGTTCTTTGGGG + Intergenic
928057980 2:28077721-28077743 ATTCCTGAGAATTTTCTTTGGGG - Intronic
928100568 2:28435121-28435143 ACTCCTGATGCCCTTCTATGGGG - Intergenic
929057714 2:37892680-37892702 CCTCCTGAAGAGTTTCTTTGAGG - Intergenic
929263783 2:39895815-39895837 ACTCTTGTTGAGGTTCTGTGAGG + Intergenic
930134199 2:47884461-47884483 ACTCCAGATTATGTTATTTGAGG - Intronic
930550509 2:52829029-52829051 ACTCTTGATGATGCTGTTTTTGG - Intergenic
932507610 2:72251174-72251196 GTTCCTGATCTTGTTCTTTGAGG + Intronic
933798373 2:85939880-85939902 TTTCTTGATTATGTTCTTTGAGG - Intergenic
934028580 2:88020801-88020823 ATTACTGATGATGTTCATTTTGG - Intergenic
935310111 2:101775227-101775249 ACACCCCATGTTGTTCTTTGTGG - Intronic
935479635 2:103570033-103570055 TTTCTTGATGATGTCCTTTGAGG - Intergenic
935526647 2:104178835-104178857 ACTCCTGCTGTCTTTCTTTGTGG + Intergenic
935639487 2:105277385-105277407 AGTCTTGATAATGTTCTTTAAGG + Intronic
938759180 2:134408409-134408431 TATCCTGATGCTGTTGTTTGTGG + Intronic
940528928 2:154854756-154854778 ACTGAAGATGAAGTTCTTTGGGG + Exonic
943366191 2:186969764-186969786 GCTCCTGATGCTGTGCTATGAGG + Intergenic
943957156 2:194207329-194207351 TCTCCTGATGAAGTGCATTGAGG + Intergenic
944845228 2:203661535-203661557 ACTGTTGATGATGTTCTCTAAGG + Intergenic
944906479 2:204266659-204266681 ACTCCAGAAGCTGTTATTTGGGG - Intergenic
945428230 2:209734473-209734495 ATTCCTGATGACGTCGTTTGAGG - Intergenic
947054035 2:226079969-226079991 ACTCCTGCTTATGCTATTTGTGG - Intergenic
948091111 2:235296508-235296530 AGTCCTGCTCATTTTCTTTGAGG - Intergenic
1170162798 20:13332123-13332145 ATTTCTGACAATGTTCTTTGTGG + Intergenic
1170861546 20:20108929-20108951 TGTCCTGAGGATGTCCTTTGTGG + Intronic
1174106717 20:48167561-48167583 ACTGCTGATGTTTTGCTTTGGGG + Intergenic
1175081563 20:56424930-56424952 ACTCCTGAAGTTGTGCTGTGAGG - Intronic
1175161954 20:57014895-57014917 ACACTGGATGGTGTTCTTTGGGG + Intergenic
1175307809 20:57989325-57989347 ACTCCAGCTGATATTCTGTGTGG + Intergenic
1175748501 20:61478262-61478284 ACTCCTGATCATGTCCGTTCTGG - Intronic
1176043208 20:63077728-63077750 ACTGAATATGATGTTCTTTGTGG + Intergenic
1177443434 21:21158914-21158936 CCTCCTGATGAACTTGTTTGAGG - Intronic
1177950526 21:27530164-27530186 ACTTTTGATGATGTTTTTTGAGG + Intergenic
1179436480 21:41365771-41365793 AATCCTGTTTAAGTTCTTTGAGG + Intronic
1183137586 22:35903956-35903978 ACTCCTTATGATGGTCTTTAAGG + Intronic
1183182107 22:36267186-36267208 CTTCCTGATGATGGTCATTGGGG + Exonic
1183827822 22:40402231-40402253 CATCTTGCTGATGTTCTTTGGGG + Intronic
949795588 3:7846923-7846945 ATTCCTCATGATGTTCTTTATGG - Intergenic
951896473 3:27614425-27614447 ACATCTGATGATGTGCTTTCTGG - Intergenic
952302862 3:32119920-32119942 AAACCTGATGAATTTCTTTGAGG - Intronic
955110124 3:55940704-55940726 ATTCCCAATGATGTTTTTTGAGG - Intronic
955638804 3:61059649-61059671 ACAACTGATGATTGTCTTTGAGG + Intronic
956280607 3:67552079-67552101 ACTCCTGATGATGGCTTCTGGGG + Intronic
956802458 3:72772771-72772793 AGTCCTGATGATGATCTTGATGG + Intronic
956803064 3:72780624-72780646 ACCCCCAAAGATGTTCTTTGTGG - Intronic
958174536 3:89979306-89979328 CCTCCTAATGATGTGCTTTGTGG + Intergenic
958261278 3:91383999-91384021 ATTGCTGATGTTTTTCTTTGTGG + Intergenic
960376946 3:116914724-116914746 CCAGCTGATGATGTTCTTTAAGG + Intronic
962869165 3:139473241-139473263 ACTCTTAATGATGTAATTTGTGG + Intronic
962869856 3:139478528-139478550 TCTTCTGATGATGCTCTTGGTGG - Intronic
964775880 3:160276522-160276544 ACTCCTGATGTAGTTTGTTGTGG - Intronic
965842669 3:172925240-172925262 ACTCCTTCTAATCTTCTTTGTGG - Intronic
967952069 3:194848778-194848800 AGTGCTGATGATTTGCTTTGTGG + Intergenic
970602367 4:17650482-17650504 TCTCCTGATTCTTTTCTTTGGGG + Intronic
975691667 4:76970852-76970874 ACTCCTGAAGCTGTTTTTTATGG + Intronic
978739947 4:112125150-112125172 ATTCTTGATGATGTCCTTTAAGG - Intergenic
979047501 4:115886708-115886730 ACTCCTGATGAAATTCTTAGAGG - Intergenic
981491526 4:145345493-145345515 AATCATGATGATATTCTTAGAGG - Intergenic
982758083 4:159248111-159248133 ATTTCTGATGATTTGCTTTGTGG + Intronic
984490342 4:180426764-180426786 AATCCTGAAGACTTTCTTTGAGG + Intergenic
986304462 5:6505083-6505105 TGTTCTGATGATGTCCTTTGTGG - Intergenic
988673565 5:33408237-33408259 GCTCATGATGATGTTCTCTCAGG + Intergenic
988900541 5:35727680-35727702 CCTCCTGATGATTTTCCTTTAGG - Exonic
991136611 5:63189634-63189656 ACTCCTCATGCTTCTCTTTGTGG - Intergenic
991440821 5:66646977-66646999 ATTCCTGTTGATTTTCTTTTTGG + Intronic
991652946 5:68874665-68874687 AATCCTGTTGGTGTTTTTTGGGG - Intergenic
992657016 5:78920738-78920760 ACTTCTGATGGTGATCTATGAGG - Intronic
994538863 5:101068848-101068870 ATTCCTGTTGAAATTCTTTGTGG - Intergenic
995498182 5:112771966-112771988 AATCCTCATGATATCCTTTGAGG - Intronic
995817666 5:116190215-116190237 AGTCCTGATGGTGTATTTTGAGG + Intronic
997049649 5:130364369-130364391 GCACCTGATGAGGTTCTGTGTGG - Intergenic
997723021 5:136095700-136095722 ACACAAAATGATGTTCTTTGTGG + Intergenic
998909691 5:146945584-146945606 GCTGCTGATGATGTTTTTTAAGG + Intronic
999107832 5:149089386-149089408 TTTCTTGATGGTGTTCTTTGAGG - Intergenic
999218959 5:149959503-149959525 ACTCCTGATGCTGCCCCTTGTGG - Intergenic
1000942494 5:167379119-167379141 AATCCTCATAATGTACTTTGAGG + Intronic
1001320375 5:170675652-170675674 ACTACTAATGATGTTTTTAGTGG - Intronic
1003338836 6:5200400-5200422 GCTCCTGAGGAGGCTCTTTGGGG - Intronic
1003973363 6:11320521-11320543 ACTCCTGAGGATGGCATTTGAGG - Intronic
1008265262 6:49417460-49417482 ACTCCTGAACATGTCCCTTGTGG - Intergenic
1008681157 6:53873854-53873876 ATTCCATATGATGTTCATTGTGG + Intronic
1008909636 6:56719600-56719622 TCTCCTGATAATTCTCTTTGAGG - Intronic
1009182490 6:60535241-60535263 ATTGCTGATGTTTTTCTTTGTGG - Intergenic
1009198190 6:60712259-60712281 AGTCCTGAAGATGATATTTGTGG + Intergenic
1009339894 6:62541402-62541424 ACCCATCATGATCTTCTTTGGGG - Intergenic
1010916273 6:81623006-81623028 ACTCCTGCTGATGTAGTTTCAGG + Intronic
1010993707 6:82508935-82508957 GATCCTGAAGATTTTCTTTGAGG + Intergenic
1014499588 6:122169488-122169510 TATACTGTTGATGTTCTTTGGGG - Intergenic
1016201267 6:141412056-141412078 TTTCCTAATGATGTCCTTTGAGG + Intergenic
1022632891 7:32102316-32102338 ACTCTGGATGATGTTCTTTGAGG - Intronic
1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG + Intronic
1027581673 7:80004671-80004693 ATTCCTTATGATGTTCTATGAGG - Intergenic
1028047192 7:86137006-86137028 CTTCCTCATGAGGTTCTTTGAGG + Intergenic
1028193892 7:87882498-87882520 ACTCCTGAAAATGTCCTTTGAGG - Intronic
1029102469 7:98143687-98143709 ATTGCTGAAGATGTTCTTTCTGG + Intronic
1029344414 7:99967962-99967984 AATTTTGATGATGTTCTTTTTGG + Intronic
1030710817 7:112747147-112747169 AGTCCTCATGATGATCTTTCAGG - Intergenic
1033182529 7:139194912-139194934 AATCCTGATGATTATCTATGTGG - Intergenic
1034178160 7:149116697-149116719 ACTCCTTATCTTGTCCTTTGGGG + Intronic
1036024150 8:4884336-4884358 TTTCCTGATGATTTCCTTTGAGG + Intronic
1037679774 8:21087411-21087433 ACTCCTGTTAATGTTGTTTCTGG - Intergenic
1037704523 8:21307965-21307987 ACTCCTGACCATGTTTTTTTTGG - Intergenic
1038928210 8:32163971-32163993 AATCCTGATGATGTCAATTGTGG + Intronic
1039764524 8:40613898-40613920 AGCCCTTATGATTTTCTTTGGGG - Intronic
1044346704 8:91112616-91112638 ACTGATGATGATGTTAGTTGTGG - Intronic
1044899324 8:96927259-96927281 CTTCCTGATGATGTTTTTAGGGG + Intronic
1045514514 8:102845988-102846010 CCTACTGATGATGTTCAATGAGG + Intronic
1045831190 8:106462694-106462716 ACTCCTGATGCAGTGCTTTCTGG - Intronic
1047108677 8:121764250-121764272 ACTCCCTGTGATCTTCTTTGGGG + Intergenic
1049645056 8:143732461-143732483 AACCCTGCTGATGTTGTTTGAGG + Intronic
1050047729 9:1565067-1565089 ACACATGATGATATTCCTTGTGG + Intergenic
1051317869 9:15862799-15862821 AGTACTGATGAGGTTCTATGAGG - Intronic
1052098742 9:24416728-24416750 AATCCTGATGAGTTTATTTGAGG + Intergenic
1053854251 9:42321533-42321555 ACTACAGATGACCTTCTTTGTGG + Intergenic
1054569972 9:66800125-66800147 ACTACAGATGACCTTCTTTGTGG - Intergenic
1054973458 9:71115772-71115794 TCTCCTGATGACCTTTTTTGTGG - Intronic
1055760583 9:79602988-79603010 GACCCTGAGGATGTTCTTTGGGG + Intronic
1057292692 9:93817373-93817395 CTTCCTGATGGTGTTCTTTGAGG + Intergenic
1061322742 9:129841524-129841546 TGTCCTGGGGATGTTCTTTGTGG + Intronic
1187046058 X:15648144-15648166 ACTGGTGAGGATGTTCTTTGCGG + Intronic
1187052037 X:15704446-15704468 ACTGGTGAGGATGTTCTTTGCGG + Intronic
1188059113 X:25578311-25578333 TGTCCTAATGATGTTATTTGAGG - Intergenic
1188523675 X:31066125-31066147 ACTACTGATCATGTATTTTGTGG - Intergenic
1189523368 X:41794191-41794213 TCACCTGATGATGATATTTGGGG - Intronic
1190430469 X:50373559-50373581 ACTTCTGTTGATGTTGTCTGAGG + Intronic
1196746616 X:119076978-119077000 AATGCTGATGATGCTGTTTGGGG - Intergenic
1197557171 X:127970210-127970232 ACTCCTGTTAATGTTATTTTTGG + Intergenic
1200269096 X:154664555-154664577 TCTCCTACTGATTTTCTTTGTGG + Intergenic