ID: 1070444569

View in Genome Browser
Species Human (GRCh38)
Location 10:76483571-76483593
Sequence GCCCCTATTGCCCCAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070444569_1070444571 -10 Left 1070444569 10:76483571-76483593 CCTGGTTCTGGGGCAATAGGGGC 0: 1
1: 0
2: 2
3: 14
4: 149
Right 1070444571 10:76483584-76483606 CAATAGGGGCAGGCGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070444569 Original CRISPR GCCCCTATTGCCCCAGAACC AGG (reversed) Intronic
900374461 1:2347127-2347149 GGCCCCATGGCCCCAGGACCTGG + Intronic
900384705 1:2405021-2405043 GCCCCCATACCCCCAGGACCTGG + Exonic
901063435 1:6484382-6484404 GCCCCCAGTGCCCCTGAGCCTGG - Intronic
901640249 1:10689392-10689414 GCCCCCACAGCCCCAGAATCTGG - Intronic
901762149 1:11478576-11478598 ACCCCTCTGGCACCAGAACCCGG - Intergenic
902404575 1:16175663-16175685 GCCCCTGCTGCCCCAGGCCCAGG - Intergenic
903056208 1:20637979-20638001 GCCTACATTGCCCCAGAACCTGG + Exonic
904533504 1:31184008-31184030 GCCCCTTTGCCCCCAGGACCGGG - Exonic
904873112 1:33634177-33634199 CCCACTCCTGCCCCAGAACCAGG - Intronic
905291031 1:36922038-36922060 GCCCCTATGACCACAGCACCAGG + Intronic
906536995 1:46556501-46556523 GCCCCTGGAGACCCAGAACCAGG - Intergenic
907871273 1:58445665-58445687 GCCCCTATTTCTCCAGAAGAGGG - Intronic
912360466 1:109090820-109090842 GCCGCTATTACCACTGAACCCGG + Exonic
913134920 1:115879002-115879024 GCCCCAATTACCTCAGCACCTGG - Intergenic
913183286 1:116343484-116343506 GCCTCTATTTGCCCCGAACCTGG - Intergenic
917065488 1:171088017-171088039 GCCACTATTGCCCCAGGGGCAGG - Intergenic
924205176 1:241704962-241704984 TCCCCCATTGGCCCACAACCAGG - Intronic
1066407040 10:35127644-35127666 GCCCGTTTTCCCCCAAAACCTGG + Intronic
1069739126 10:70676263-70676285 GCACCTATAGCCCCAGCTCCTGG - Intronic
1069779252 10:70944500-70944522 GCCCCCATTCCCCCAGTTCCTGG + Intergenic
1070444569 10:76483571-76483593 GCCCCTATTGCCCCAGAACCAGG - Intronic
1071590813 10:86871223-86871245 GCCCCTATTCCTTCAGGACCTGG + Intronic
1075724382 10:124604031-124604053 GCCCCTCTTCTCCCAGGACCTGG - Intronic
1077613310 11:3658532-3658554 TCCCCTCTTCCCCCAGCACCCGG + Intronic
1079247318 11:18762063-18762085 CCCCCCAATGCCCCAGAGCCAGG - Intronic
1080787317 11:35487364-35487386 GTCCCTATTGCCCCTCTACCAGG + Intronic
1082263319 11:50094754-50094776 GCCTCAGATGCCCCAGAACCTGG + Intergenic
1083724127 11:64619561-64619583 GGCCCCATTGCCCCAGGCCCTGG + Intronic
1084006777 11:66327205-66327227 GCCCCAAATGCCCCAGCCCCTGG + Intergenic
1084205014 11:67586160-67586182 GACCCTGCTGTCCCAGAACCAGG + Exonic
1086210985 11:84318502-84318524 GCCTATACTGCCCCAGCACCTGG - Intronic
1088128124 11:106452940-106452962 GCCACAACTGCCCCAGACCCAGG - Intergenic
1089659858 11:119978741-119978763 GTCCCTCTTGCCCCAGCAGCTGG + Intergenic
1093969121 12:25358469-25358491 GCCCCTGTTACCTCAGACCCAGG + Intergenic
1095742966 12:45626596-45626618 GCTCCCATCGCCCCAAAACCTGG - Intergenic
1096623313 12:52878006-52878028 GCCCCTACTACTCCAGCACCTGG - Intergenic
1097062227 12:56293963-56293985 GCTCCTCTCTCCCCAGAACCAGG + Intronic
1097359470 12:58642572-58642594 CTCACTATTGCACCAGAACCTGG + Intronic
1097462476 12:59878901-59878923 GCGCCTGTAGTCCCAGAACCCGG + Intergenic
1100303720 12:93331571-93331593 GCACCTGTTTCCCCAGCACCTGG + Intergenic
1100745867 12:97644965-97644987 GCCTCACTTGCCACAGAACCAGG - Intergenic
1101545357 12:105707147-105707169 GACCCTCTTGCCCCAAAGCCAGG + Intergenic
1101930084 12:109006678-109006700 GCCCTCATCACCCCAGAACCAGG - Intronic
1102490842 12:113288740-113288762 GCCCCTGTCGCCCCACAGCCTGG + Exonic
1103160627 12:118726267-118726289 GCCCTAATTGCCCCAGTGCCAGG + Intergenic
1104694622 12:130853770-130853792 GCCGCTATTGCCCCATCACTTGG + Intergenic
1104950532 12:132437864-132437886 GCCCCTGTGGCCCCTGAGCCAGG + Intergenic
1105675599 13:22668526-22668548 ATACCTATTGACCCAGAACCAGG - Intergenic
1108586448 13:51874168-51874190 GCCCTTATTGCCCCTGCAGCAGG - Intergenic
1113484569 13:110644984-110645006 GCCCCTGTTGCCCTAGAGCTGGG + Intronic
1113736732 13:112684395-112684417 GCCCCTGTCACCCCAGACCCAGG - Exonic
1113890234 13:113731701-113731723 CCCACTGTTGCCCCAGACCCTGG + Intronic
1118947327 14:70399465-70399487 GCCTCTGTTGCTCCAGACCCTGG - Intronic
1125545276 15:40498857-40498879 GACCCTTTTCCCCCAGAGCCAGG - Intergenic
1126516076 15:49539493-49539515 GTCCCTACTGCCCCAGACCCTGG - Intronic
1130759819 15:86807240-86807262 GCCCCAATTAACCCAGACCCTGG - Intronic
1134818588 16:17227192-17227214 GCCCCCATTGCCCCATGACCAGG - Intronic
1136368597 16:29821481-29821503 GCCTCTGCTCCCCCAGAACCTGG - Intronic
1139296324 16:65904605-65904627 CCCCCGATTTCCCCAGACCCTGG - Intergenic
1140014836 16:71171921-71171943 ACCCCTGTAGCCCCAGTACCTGG - Intronic
1142490341 17:274413-274435 GCCCCTGTGGCCCCAGGAACTGG - Intronic
1143161908 17:4877442-4877464 GCCCCAATTGCCTCAAACCCTGG + Intronic
1143627495 17:8118836-8118858 GTCCCTAGTGGCCCAGATCCCGG - Exonic
1143741062 17:8954432-8954454 GCCCTGATTGCCCCACAGCCTGG + Intronic
1144771004 17:17759510-17759532 GGCCCAGTTGCTCCAGAACCAGG + Intronic
1145878285 17:28335927-28335949 GCGCCTTTTCCCCCAGGACCCGG - Intronic
1148421373 17:47550059-47550081 GCGCCTATAGCCCCAGATGCTGG - Intronic
1148568818 17:48650207-48650229 TCCCCTCTTTCCCCAGCACCTGG + Intergenic
1151505081 17:74522195-74522217 GCCCCTCATGCCCTAGAACCAGG + Exonic
1152626792 17:81391333-81391355 GCCCCTGTTCCCCCACAACCGGG - Intergenic
1153067447 18:1062497-1062519 ACCCCTACTGACCAAGAACCTGG - Intergenic
1155169266 18:23255087-23255109 GCCCTTATCACCCCAGAGCCAGG - Intronic
1157884923 18:51357741-51357763 GCCCCAATCACCCCAGAGCCAGG + Intergenic
1164563607 19:29310555-29310577 GGCCCTGTTTCTCCAGAACCTGG + Intergenic
1165906275 19:39196654-39196676 GCCCCTCTTCCCGCAGACCCAGG - Intergenic
1166299070 19:41904019-41904041 CCCCCTCCTGCCCCAGAACCTGG + Exonic
1166525345 19:43507096-43507118 GCCCCTCTTCCCTCAGACCCAGG + Intronic
1166525560 19:43507676-43507698 GCCCCTACTCCCTCAGAGCCAGG + Intronic
1166525573 19:43507713-43507735 GCCCCTACTGCCTCAGACCCAGG + Intronic
1166567806 19:43775773-43775795 CTCCCTCTTGCCCCAGACCCAGG - Intronic
1166662150 19:44654172-44654194 GCCCCTCTTCCCTCAGACCCAGG - Intronic
1166682670 19:44778341-44778363 GCCCCTCCTCCCCCAGACCCAGG + Intronic
1166688472 19:44809514-44809536 GCCCCTCTTTCCTCAGACCCAGG + Intronic
1166794834 19:45419991-45420013 GCCCCTCCTGCCTCAGACCCAGG + Intronic
1166995048 19:46716253-46716275 ACCGCTACTGCCCCAGATCCCGG - Exonic
1167298283 19:48664395-48664417 GCCCCTCTTCCCTCAGACCCAGG + Intronic
1167314312 19:48755076-48755098 GCCCCTACTCCCTCAGACCCAGG + Intronic
1167327634 19:48835458-48835480 GCCCCTCTTCCCTCAGACCCAGG - Intronic
1167743384 19:51337719-51337741 GCCCCTCTTCCCTCAGACCCAGG - Intronic
1168126373 19:54285785-54285807 GCCCCTGCTGCCCCAGGCCCAGG + Intergenic
1168223651 19:54979109-54979131 GCACCTATAGTCCCAGCACCTGG - Intronic
1168263169 19:55207918-55207940 GCCCCTACTCCCTCAGACCCAGG - Intronic
1168283717 19:55320272-55320294 GCCCCTCTTTCCCCAAAATCCGG - Intronic
1168343613 19:55640303-55640325 GCCTCAAGTGCCCCAGGACCTGG + Intronic
926386009 2:12336449-12336471 GCCACTATTGTCCCTGGACCTGG - Intergenic
928584199 2:32741689-32741711 ACAGCTGTTGCCCCAGAACCTGG + Intronic
932893805 2:75619322-75619344 GCCCTAATTACCCCAGGACCAGG + Intergenic
936528242 2:113256995-113257017 CCCCCTATGTCCCCAGAACCTGG - Intronic
937238027 2:120442340-120442362 GCCCCGAAGGCTCCAGAACCCGG + Intergenic
939067587 2:137503354-137503376 GCCACTGTTGCCCTAGACCCTGG + Intronic
940504770 2:154539149-154539171 GCCATTATCCCCCCAGAACCAGG - Intergenic
942826379 2:180181728-180181750 CCCACTATTTCCCCAGAAGCAGG - Intergenic
1168871203 20:1130153-1130175 TCCCCTCTTGCCCCAGTATCTGG - Intronic
1173774950 20:45697476-45697498 GCGCCTATAGTCCCAGCACCTGG - Intronic
1173912454 20:46680471-46680493 GCACCTATTGCCCCAGAGGCAGG + Intronic
1175466025 20:59191775-59191797 GCCCCTACTTGCCAAGAACCTGG + Exonic
1176179342 20:63742114-63742136 GCCCCTGTTGCTGCAGAGCCCGG + Exonic
1180227558 21:46404495-46404517 GCCCCTTCTCCCCCAGCACCAGG - Intronic
1181038348 22:20180423-20180445 GCCCCAAGTGCCCCCGAGCCCGG + Intergenic
1181038835 22:20182409-20182431 TCTCCCAATGCCCCAGAACCAGG - Intergenic
1181460350 22:23082688-23082710 GCCCCTCTTTCCCCAGGACTAGG + Intronic
1181620615 22:24088706-24088728 GCCCCTACTACCTCAGAAACAGG + Intronic
1183404596 22:37624201-37624223 GCCCAGATTGCCCCACACCCTGG + Intronic
1185421839 22:50739136-50739158 GCCCCTGCTTTCCCAGAACCCGG + Intronic
951202816 3:19893431-19893453 CCCCCTATTGCCACAAAATCAGG - Intronic
951221072 3:20069470-20069492 TCCCCTATATCCCCAGAAGCAGG - Intronic
952577217 3:34789965-34789987 GCCCCTATTGTCCCAGAATCAGG + Intergenic
954147950 3:48643518-48643540 CCCTCCCTTGCCCCAGAACCAGG - Intronic
955843236 3:63134114-63134136 TCCCCTTTTCCCCCAGACCCTGG - Intergenic
956624455 3:71253058-71253080 GCCCCACTTGGCCCAGTACCTGG - Intronic
956855881 3:73274289-73274311 GTCCCTATTGCCCCACATCATGG - Intergenic
961211880 3:125131861-125131883 GTCCTCATTTCCCCAGAACCTGG - Intronic
962396280 3:135017720-135017742 GCTCCTGTTGCCCAAGCACCTGG + Intronic
962846157 3:139275549-139275571 GACCCTATTTCCCCTGAAGCAGG + Intronic
968547516 4:1206428-1206450 GGCCCTCTGGCCCCACAACCTGG - Intronic
975806735 4:78120564-78120586 GCCCCTTTTTCCCCAGAGCCTGG - Intronic
983090653 4:163497789-163497811 GCCCTGATTCCTCCAGAACCTGG - Intronic
984951278 4:185009549-185009571 GCCCCTGGAGCCCCAGAAGCTGG + Intergenic
984982338 4:185294497-185294519 GCCCCTCTTGCCCCAAATCCAGG - Intronic
985627586 5:997864-997886 GCCCCTGTTGCCCCAGAGCCAGG - Intergenic
995270951 5:110219531-110219553 GCCCCTACTGCCCTAAAACTGGG - Intergenic
995357276 5:111253361-111253383 GCCCTGCTTGCCCCGGAACCTGG + Intronic
1001397629 5:171428434-171428456 GACCCTCTTGCCCCAGAGTCTGG - Intronic
1002089831 5:176797928-176797950 GCCCCTATTCCCCCTGTGCCTGG - Intergenic
1004511234 6:16285977-16285999 GCCCCAATTGGCCCAAATCCTGG + Intronic
1005671668 6:28112598-28112620 GCACCTCCTCCCCCAGAACCAGG + Intergenic
1007610527 6:43145983-43146005 CCCGCTCTTGCCCCAGAACTAGG - Intronic
1010378962 6:75205435-75205457 GGCCCTGCTGCCCCAGAACCCGG + Intronic
1012074887 6:94670982-94671004 GCCCTAATTGCCCCAGGACCAGG - Intergenic
1018779101 6:167045956-167045978 ACCCCTACTGCCCCAGTGCCAGG + Exonic
1024255263 7:47536087-47536109 GTCCCTCTTGCCCCAGATACCGG - Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1032240061 7:130153437-130153459 GCCCCCATGGCCCCAGAGGCCGG - Intergenic
1033508163 7:142026840-142026862 GCTGCTTTTTCCCCAGAACCTGG + Intronic
1036170675 8:6481063-6481085 CCTCCTGTTGCCCCAGAACTTGG - Intronic
1036295920 8:7537092-7537114 GCCCCATTTGCCCCAAAGCCAGG - Intergenic
1036326646 8:7783927-7783949 GCCCCATTTGCCCCAAAGCCAGG + Intergenic
1036802546 8:11803007-11803029 GCGCCCCTTGCCCCAGATCCGGG - Intronic
1037916746 8:22777641-22777663 ACTCCTGTTGCCCCAGAGCCGGG + Intronic
1039522410 8:38182110-38182132 GTCCCTCTTGCCCCAGCATCTGG - Intronic
1045092123 8:98756862-98756884 GCCCAAATTGCCCCAGGGCCAGG + Intronic
1045871612 8:106933985-106934007 GCCCCTTTTGCCCCACATCTGGG - Intergenic
1048222285 8:132552851-132552873 GCCCCTTTTGCCCAAGTCCCTGG + Intergenic
1048291327 8:133183760-133183782 ACCCCTGTTGCCCCAGGACCTGG - Intergenic
1050111971 9:2226663-2226685 GCTTCTATAGCCCCAGCACCTGG - Intergenic
1060359380 9:122940894-122940916 GACCCTATTGGCCCAATACCGGG - Intronic
1060408072 9:123382430-123382452 GCCTCGAAGGCCCCAGAACCGGG - Exonic
1061256956 9:129459074-129459096 GCCCCTATAGCCCCTGCCCCCGG + Intergenic
1061614891 9:131773188-131773210 GCCCCAATCGCCCCAGGGCCAGG + Intergenic
1187742215 X:22368297-22368319 GACCCAAAGGCCCCAGAACCAGG - Intergenic
1189393977 X:40603550-40603572 GTCCCTACAGCCCCAGCACCTGG - Intronic
1194087085 X:89541600-89541622 GCCCCTGTTGCCCCCTACCCAGG + Intergenic
1195965022 X:110422206-110422228 TCCAGTATTGGCCCAGAACCAGG + Intronic
1198534653 X:137574353-137574375 GCCCCTTTTGCGCCAGCCCCTGG - Intronic
1199607513 X:149587523-149587545 ACCCCTACTCCGCCAGAACCCGG - Intergenic
1199631610 X:149781844-149781866 ACCCCTACTCCGCCAGAACCCGG + Intergenic