ID: 1070445457

View in Genome Browser
Species Human (GRCh38)
Location 10:76496392-76496414
Sequence CAGTTTGCTGAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070445457_1070445461 20 Left 1070445457 10:76496392-76496414 CCCAGCTCCATCTCAGCAAACTG 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1070445461 10:76496435-76496457 TCATTTGTTTTCCCTCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070445457 Original CRISPR CAGTTTGCTGAGATGGAGCT GGG (reversed) Intronic
902624694 1:17669848-17669870 CAGTGTGCAGAGACAGAGCTGGG + Intronic
903344011 1:22673075-22673097 CAGGGTCCTGGGATGGAGCTAGG - Intergenic
903557235 1:24202791-24202813 CAGGAGGCTGAGATGGGGCTCGG + Intergenic
903913665 1:26747470-26747492 TTGTTTACTGAGATGGAGATGGG + Intronic
905353052 1:37360667-37360689 CAGGCTGGTGAGATGGGGCTAGG - Intergenic
906748329 1:48237161-48237183 CAGTTTGTTGAGAAGGAGTCAGG + Intronic
907108943 1:51909018-51909040 CAGTGAGCTGTGATGGGGCTGGG - Exonic
907528662 1:55070745-55070767 CAGTGTGCTGAGACGTCGCTGGG + Intronic
908390193 1:63677213-63677235 CAGTGAGCTGAGATCGTGCTGGG - Intergenic
908508776 1:64833503-64833525 CAGTTTGCTTGGAGGTAGCTGGG - Exonic
908669941 1:66534619-66534641 CAGGGAGCTGAGATGGAGCTAGG + Intronic
912853075 1:113143821-113143843 CAGTAAGCTGAGATGCAGCCTGG + Intergenic
913479926 1:119278228-119278250 CACTGTCCTGAGATGGAGGTAGG - Intergenic
915194904 1:154182419-154182441 CAGTTGGCTGAGAGGAAGCGCGG - Intronic
915958342 1:160242392-160242414 CAGTTTTTTGAAATGCAGCTGGG + Intronic
918177750 1:182060369-182060391 CAGTTTAATGAGATGGGGATAGG - Intronic
918316297 1:183325256-183325278 AAGATTGCTGAGTTGGAGTTGGG - Intronic
918343502 1:183586503-183586525 CATTTTGCTGGGATGAAGCCAGG + Intronic
921164127 1:212493981-212494003 CAGTTGGCAGGGATAGAGCTGGG - Intergenic
922853167 1:228751562-228751584 CAGCTGGCTGAGATAGAGGTTGG + Intergenic
923126094 1:231035818-231035840 CAGTTTGCAAAAATGGAGCAAGG - Intronic
923441943 1:234028819-234028841 GAGTTTGCTGAGAGAGAGGTGGG + Intronic
924639081 1:245816359-245816381 CTGTTTGCTAGAATGGAGCTTGG + Intronic
1064064614 10:12170653-12170675 CAGTTTGCTGGGATGGGGACGGG + Intronic
1067792795 10:49300609-49300631 CAGTTTGCTGTCACGGTGCTGGG + Intronic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1072275493 10:93818356-93818378 CAGTTTGGTGACATCGAGCAAGG - Intergenic
1075221037 10:120584788-120584810 GACTTTGCTGAGAAGCAGCTTGG + Intronic
1076081618 10:127586777-127586799 CAGTGTCCTGGGATGGAGGTGGG + Intergenic
1077090710 11:777171-777193 CGGGTTGGTGGGATGGAGCTCGG - Intronic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1077629891 11:3804229-3804251 GAGTTTCCTGAGATGGAGGCAGG + Intronic
1081524601 11:43917673-43917695 TGCTTTTCTGAGATGGAGCTGGG + Intronic
1082920832 11:58492012-58492034 CTGCTTGCTGAGCTGGAGATTGG - Intergenic
1083035189 11:59630363-59630385 CAGGAGGCTGAGATGGAGGTTGG + Intergenic
1084031676 11:66484885-66484907 CAGGTGGCTGAGAGGGTGCTGGG + Intronic
1084739023 11:71126566-71126588 CAGATTCCTCAGATGGAGCTGGG + Intronic
1085758379 11:79220330-79220352 CAGTTTGCTGAGGGGAAGCCTGG + Intronic
1088545332 11:110953350-110953372 CTGTTGGCTGAGCTGGTGCTTGG + Intergenic
1089159814 11:116428741-116428763 CAGTTTCTGAAGATGGAGCTCGG + Intergenic
1089735436 11:120547408-120547430 TAGCGTGGTGAGATGGAGCTGGG + Intronic
1090342747 11:126039916-126039938 CAGTGTGCTGAGAGCGAGCAAGG - Intronic
1092461679 12:8692703-8692725 TAATGTGCTGAGATGGAGCAGGG + Intronic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1095814000 12:46401402-46401424 CCATTTGCTGAGAAGGGGCTTGG + Intergenic
1098817256 12:75182930-75182952 CAGTGTACTGAGATGGTGCTGGG + Intronic
1099657115 12:85507687-85507709 CAGTTGGTTGAGATGGAGTAAGG + Intergenic
1102532839 12:113559312-113559334 CAGTTTCCGCAGATGTAGCTGGG - Intergenic
1102877201 12:116457817-116457839 CAGTCTGCTGAACTGGAGATAGG - Intergenic
1103050817 12:117778158-117778180 CAGTCAGCTGAGATGGTGCTTGG - Intronic
1104341912 12:127958244-127958266 CACTTTGCTGAGATGACCCTAGG + Intergenic
1107857152 13:44627804-44627826 AAGTTTGCTGTGATGGAGAAGGG - Intergenic
1108507220 13:51123337-51123359 CAATCTGTTGAGATGAAGCTTGG - Intergenic
1113758808 13:112833357-112833379 CAGTTTTCTGAGATGCAGGAGGG - Intronic
1114318306 14:21526233-21526255 CAGACTGCGGAGATGGAGATCGG + Intronic
1114458246 14:22871339-22871361 CAGTTTGCAGAGAAGGGGCGGGG + Intergenic
1115030504 14:28787877-28787899 ACGTTTGATGAGATGGAGTTTGG + Intronic
1115304292 14:31917957-31917979 CACTATGCTGACATGGATCTCGG - Intergenic
1116694567 14:48156377-48156399 CATTTTACTGAGATGGGGGTTGG - Intergenic
1119268404 14:73279190-73279212 CAGTTAGCTGAGTGGGAACTAGG - Intronic
1121243835 14:92448894-92448916 CAGTTTCCTGACAGGGACCTGGG - Intronic
1121303461 14:92890124-92890146 CAGTTCACTGAGATGGAGGGAGG - Intergenic
1121555388 14:94832477-94832499 CAGGTTCCAGAGATGGGGCTTGG + Intergenic
1202884703 14_KI270722v1_random:94187-94209 CAGTTTCCTAAGCTGGAGCGCGG + Intergenic
1125364183 15:38896312-38896334 CAGATTGCTGTGATGGAGCAGGG - Intergenic
1125954628 15:43781492-43781514 CAGTGAGCTGAGATAGAGCAAGG + Intronic
1126105000 15:45141662-45141684 CATTCGGCTGAGATGGAGCTCGG + Intronic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1128786689 15:70402882-70402904 CAGTTCCCTGAGATGGACCAAGG - Intergenic
1128934397 15:71732963-71732985 GAGTTTGCTGACTTGGAGTTTGG - Intronic
1129114285 15:73356633-73356655 CTTTTTGATGGGATGGAGCTTGG + Intronic
1130696009 15:86132202-86132224 TAGCTTGCTGAGAATGAGCTGGG + Intergenic
1131150962 15:90046955-90046977 CAGTATGCTGAGAAGCAGGTGGG - Intronic
1134827497 16:17296323-17296345 AAGATTGCAGAGATGGGGCTGGG + Intronic
1135700817 16:24630925-24630947 CTGTTTGCTGGGGTGGAGGTGGG + Intergenic
1135814074 16:25616012-25616034 CAGTTTGGTGAGGTGGACTTTGG + Intergenic
1138056464 16:53839216-53839238 CAGTTTGGTTAGTGGGAGCTGGG + Intronic
1138220652 16:55247555-55247577 CAGTCTGGTGGGATGCAGCTCGG - Intergenic
1138383623 16:56620863-56620885 TAGTTTGCTGAGAATGAGCTTGG - Intergenic
1138404528 16:56779008-56779030 CAGCTTTCTGAGATACAGCTGGG - Intronic
1140558781 16:75953204-75953226 AAGTATACTGAGAAGGAGCTAGG + Intergenic
1141677537 16:85525423-85525445 CAGGATGCTGAGAAGGAGCGAGG + Intergenic
1143376956 17:6472612-6472634 GAGTGTGCTGAGCTGGAGGTGGG - Intronic
1143520851 17:7443426-7443448 CCTTTTCCTGAGATGGCGCTGGG + Exonic
1144122635 17:12170790-12170812 CAGTGAGCTGAGATGGTGCCTGG - Intergenic
1145043713 17:19595860-19595882 CTGATTGATGTGATGGAGCTCGG + Intergenic
1145917474 17:28583946-28583968 CAGGTTGCTCACCTGGAGCTGGG - Exonic
1146008637 17:29177969-29177991 CACCCTGCTGAGGTGGAGCTGGG - Intronic
1146615766 17:34356347-34356369 GAATCTGCTGAGCTGGAGCTGGG - Intergenic
1148076823 17:44941938-44941960 CTTCTTGCTGAGATGGTGCTGGG + Intronic
1148765816 17:50037668-50037690 CAGGCTGCTGAGATGGGGGTGGG - Intergenic
1148807462 17:50271173-50271195 CAGTTTGGTGTCATGGAACTGGG + Intergenic
1149371583 17:55998766-55998788 CAGTTTCTTGAGATACAGCTTGG + Intergenic
1151968663 17:77445687-77445709 CAGTTGGCTGAGTTGGAGGTGGG + Intronic
1154297629 18:13164412-13164434 GCAATTGCTGAGATGGAGCTAGG + Intergenic
1156910800 18:42409097-42409119 CAGTTGACTGAGATGTACCTAGG + Intergenic
1159161440 18:64647230-64647252 CAGGTGGCTGAGATGGGGTTAGG - Intergenic
1159497904 18:69229767-69229789 CAGATTGCTGATATTGAGTTTGG - Intergenic
1160196336 18:76758635-76758657 CAGTTTTCTGAGCAGGAGCCAGG - Intergenic
1160240465 18:77119098-77119120 CAGGTCCCTGAGGTGGAGCTGGG + Intronic
1161169573 19:2806084-2806106 CAGTCTGCTCAGATGGGGCGTGG + Intronic
1167256796 19:48435345-48435367 CAGTGAGCTGAGATGGTGCCCGG - Intronic
1168091875 19:54091009-54091031 CTTTTTTATGAGATGGAGCTTGG + Intergenic
1168604316 19:57746441-57746463 CAGGCCGCTGAGATGGAGCTGGG + Intronic
925337235 2:3107374-3107396 CTGTTTGCTGAGAAGAATCTGGG + Intergenic
926163665 2:10505053-10505075 CAGTCAGCTGAGATGGGACTGGG + Intergenic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
928198554 2:29232103-29232125 CATCTTGCTGACCTGGAGCTTGG - Intronic
928965575 2:36971750-36971772 CAGTGAGCTGAGATGGTGCCAGG - Intronic
929572102 2:43029172-43029194 GTGTCTGCTGAGATGGTGCTGGG + Intergenic
930748641 2:54910597-54910619 CAGTTTGCTGAGAGGCAACTGGG + Intronic
931081849 2:58782413-58782435 CAGTGAGCTGAGATGGTGCCTGG + Intergenic
931432374 2:62218464-62218486 CTGTTTCCTGAGGTGGGGCTGGG + Intronic
931916060 2:66957817-66957839 CAGTTTGCTGTGGTCAAGCTTGG + Intergenic
933556474 2:83836623-83836645 CAGTGAGCTGAGATGGCGCCAGG + Intergenic
935217518 2:100986246-100986268 CAGGTGGCTGAGCTGGGGCTGGG - Intronic
945002981 2:205371485-205371507 CACTGTGCTGACATGGAACTAGG + Intronic
945743610 2:213693384-213693406 CAGTGTGCTGAGGTAGGGCTTGG - Intronic
946039796 2:216773809-216773831 AAGTTGGGTGAGATGGAGATGGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947737741 2:232465510-232465532 CAGTGAGCTGAGATCGTGCTTGG - Intergenic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
948624598 2:239261373-239261395 CCGTGTGCTGAGATGGAGCGTGG + Intronic
948719387 2:239889154-239889176 CCTTTGGGTGAGATGGAGCTGGG - Intergenic
1168770104 20:408979-409001 CTCTGTGCTGAGATGGGGCTAGG + Intronic
1169000964 20:2167767-2167789 CAGTGAGCTGAGATGGTGCCAGG - Intronic
1169245213 20:4019462-4019484 CAATTTTCTGAGATGGATTTGGG - Intergenic
1169360670 20:4946207-4946229 CTGGTTTCTGAGATGGAACTTGG - Intronic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1171540318 20:25945874-25945896 CTGTTTACGGAGATGTAGCTAGG - Intergenic
1172099742 20:32477990-32478012 CAGTTATCAGAGCTGGAGCTAGG - Intronic
1173087119 20:39933284-39933306 CAATTTGCTGAGAGGTACCTTGG + Intergenic
1174414214 20:50356554-50356576 CAGCTGGCAGAGGTGGAGCTGGG + Intergenic
1175569899 20:60010589-60010611 GAGTTTGCTGGGTTGGAGATTGG + Intronic
1175960405 20:62633482-62633504 CAGTGAGCTGAGATGGTGCCTGG + Intergenic
1176109378 20:63404516-63404538 CAGGTAGCTGAGACGGAACTGGG + Intergenic
1180327593 22:11444809-11444831 CAGTTTCCTAAGCTGGAGCGCGG + Intergenic
1181138527 22:20786592-20786614 CAGTGTGGGGAGCTGGAGCTGGG + Intronic
1182267056 22:29125260-29125282 CAGTTTGCTGGGATGGAGTCAGG + Exonic
1182869905 22:33636825-33636847 CAGTTAGTTGACATGGGGCTGGG - Intronic
1182937604 22:34240465-34240487 CAGCTTGCTGAGATGGATTCAGG + Intergenic
1183552469 22:38498670-38498692 CACTTTGGAGAGATGAAGCTGGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949492117 3:4599177-4599199 CGGTTTGCTGATATGGATATGGG + Intronic
951702482 3:25510136-25510158 CAGTTTCCTGAGATTGAGAGAGG + Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963506175 3:146187568-146187590 CAGCTTTCTGACATGGAGCGGGG + Intergenic
964730225 3:159857028-159857050 CAGGTGGCTGAGGTGGGGCTAGG - Intronic
964852139 3:161105829-161105851 GAGTTTGAGGAGATGGATCTGGG - Intronic
968481829 4:836729-836751 CAGTGTGCTGGGAGGGACCTGGG - Intergenic
968513398 4:1005032-1005054 CAGTTTACAGAGATGGAGGCAGG + Intergenic
970565012 4:17323468-17323490 CATTTTGCTGTGATGGAGCAGGG - Intergenic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
971810268 4:31416332-31416354 CAGTGGGCTGAGATGGAGGGTGG + Intergenic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
975404192 4:73969803-73969825 CAGAGTGCTGAGAAGGAGCATGG + Intergenic
975573785 4:75843252-75843274 CAATTTGAAGGGATGGAGCTGGG + Intergenic
975733806 4:77362891-77362913 GTCTTTGCTGAGATGGAGTTTGG + Intronic
975961178 4:79907425-79907447 CCTTTTACTGAGATGGAACTCGG + Intronic
976924270 4:90477300-90477322 CAGTTAGATGACATGGAGCAAGG + Intronic
977791277 4:101106633-101106655 CAGTTTGCTGATATGGCCATAGG - Intronic
977894260 4:102345767-102345789 CAACTTGCTGAAATGGAGCCTGG + Intronic
981447793 4:144860453-144860475 CAGTTTTCTGAGATTATGCTGGG + Intergenic
982083149 4:151809567-151809589 CAGTGTGCTGAGGTGGCCCTGGG - Intergenic
988314734 5:29610146-29610168 AAGTTTGCTGAGATGGCGAATGG - Intergenic
990649821 5:57885681-57885703 CAGCTTTCTGAGCTGCAGCTAGG + Intergenic
993634616 5:90328335-90328357 CAATTTCCTGAGATTGAACTAGG - Intergenic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
994559448 5:101348547-101348569 CAGTGAGCTGAGATGGCGCCTGG - Intergenic
997913165 5:137896526-137896548 CAGTCTGCTGAGTAGCAGCTAGG + Intronic
999059887 5:148622386-148622408 AAGTTTGGTGAGATGTGGCTGGG - Intronic
1000600738 5:163271862-163271884 CAGCTGGCTGTGGTGGAGCTGGG - Intergenic
1000940654 5:167356122-167356144 CAGTGAGCTGAGATGGAGATGGG + Intronic
1002095057 5:176825728-176825750 CATTTTGCTGCCATGGAGCTGGG - Intronic
1005393862 6:25361410-25361432 GAATTTGCTGAGATCAAGCTTGG - Intronic
1006298647 6:33181381-33181403 GTGTTTGCTGAGGTGGGGCTGGG - Intronic
1006865648 6:37207097-37207119 CCACTTGGTGAGATGGAGCTGGG + Intergenic
1006947735 6:37796636-37796658 CAGTTTTCTGTGATTGAGCCTGG - Intergenic
1010023868 6:71193318-71193340 CAGGTTGCTGACATGGAGGGTGG + Intergenic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1012735083 6:102928615-102928637 CATTTTGCTGAAATGGTGTTAGG - Intergenic
1014130823 6:117830016-117830038 AAGTTTGCTACGCTGGAGCTGGG + Intergenic
1016072786 6:139760758-139760780 CAGTTTGCTCAGCAGGTGCTGGG - Intergenic
1018640334 6:165898808-165898830 CAGTGCGCTGGGATGGAGCAGGG - Intronic
1020006111 7:4784507-4784529 CAGCCTGCTGACCTGGAGCTAGG + Intronic
1020228483 7:6298716-6298738 CAGTGAGCTGAGATGGAGCCTGG - Intergenic
1022345110 7:29507043-29507065 GAGTTTGGTGAGAGGGAGGTAGG - Intronic
1023542237 7:41277981-41278003 TAGTCTGCTGATATGGAGCTGGG - Intergenic
1024059336 7:45686412-45686434 CAGCTTGCTGGGATTGACCTTGG - Intronic
1024252421 7:47516601-47516623 CTGCTTACTGAGTTGGAGCTGGG - Intronic
1024894759 7:54245141-54245163 CAGTTTCCTGACACTGAGCTAGG + Intergenic
1025114895 7:56249178-56249200 CAGCTTGTTGATGTGGAGCTGGG - Intergenic
1025256268 7:57385658-57385680 CAGCTGGCAGAGGTGGAGCTGGG - Intergenic
1025291751 7:57732116-57732138 CTGTTTACGGAGATGTAGCTAGG - Intergenic
1028638300 7:93015834-93015856 CAGCTTCCTGAGAAGGGGCTAGG + Intergenic
1029186889 7:98745752-98745774 CCTTTTTCTGAGCTGGAGCTAGG - Intergenic
1029803665 7:102975426-102975448 CAGTAGGCTGAGCAGGAGCTTGG - Intronic
1033528791 7:142243313-142243335 AAGTTTGAGGAGGTGGAGCTGGG - Intergenic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1035976041 8:4312814-4312836 CAGTTAGCTGAGATCGCGCCAGG + Intronic
1036478090 8:9112199-9112221 CCGATTCCTGTGATGGAGCTGGG - Intronic
1037917382 8:22780958-22780980 CAGTTTCCTCAGCTGGAGATGGG - Intronic
1039399743 8:37259724-37259746 CAGTTTGCTGAGTTGCAAATGGG + Intergenic
1039948739 8:42152163-42152185 CACTTTGGTGAAATGGAGCGTGG - Intergenic
1041139930 8:54806454-54806476 CATTTTGCTAAGATGTAGCCAGG - Intergenic
1044016055 8:87049931-87049953 CAGACTGCTGGGATGGACCTTGG + Intronic
1045803647 8:106130834-106130856 CAGATAGCTGAGATGATGCTAGG - Intergenic
1045847247 8:106652237-106652259 CAATTTGCTGAGAGTGAGCTTGG + Intronic
1048666616 8:136669127-136669149 CAGTTTGCTGAGAACAAACTTGG - Intergenic
1048975409 8:139669796-139669818 CAGATTTCTGTGATGGATCTCGG - Intronic
1049202922 8:141350639-141350661 CACTCTGCTGAGATGGAGTGGGG - Intergenic
1049799349 8:144510582-144510604 CAGTTTCCTGGGATGGGGGTGGG - Exonic
1050907847 9:11027499-11027521 CAGTGTGTTGAGATTGAGCAGGG + Intergenic
1053583663 9:39433988-39434010 CAGTGAGCTGAGATCGTGCTTGG + Intergenic
1054105243 9:60992731-60992753 CAGTGAGCTGAGATCGTGCTTGG + Intergenic
1054164748 9:61713585-61713607 CTGTTTACGGAGATGTAGCTAGG + Intergenic
1055438243 9:76313913-76313935 GAGTTTGCTGGGGTGGAGCTCGG - Intronic
1057708262 9:97412902-97412924 CAGCTTGCTAGGAGGGAGCTTGG + Intronic
1059627263 9:116080654-116080676 CAGTTGTCTGGGGTGGAGCTGGG + Intergenic
1060374828 9:123108543-123108565 CAGGTTGTTGAGGTGGAACTGGG - Intergenic
1061425105 9:130493696-130493718 GAGTTTCCTGAAATGGAGCCTGG - Intronic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1062354535 9:136155526-136155548 CAGTTTGAGGAGCAGGAGCTGGG - Intergenic
1062670028 9:137703066-137703088 CAGTGTCCTGAGATGTATCTGGG + Intronic
1185761192 X:2691062-2691084 CAGTTTCCTGAGAAGGGGCGGGG + Intergenic
1187565260 X:20443323-20443345 CCATTTGCTGAGATGGAGGAGGG + Intergenic
1188499479 X:30809874-30809896 TTTTTTGCTGACATGGAGCTGGG - Intergenic
1189322036 X:40092556-40092578 CAATTTGCTAAGGTGGAGCAGGG - Intronic
1190855899 X:54294643-54294665 CAGTTTGCTGAGCGGGAGCAAGG + Exonic
1191001387 X:55663214-55663236 CAGTTTTCTGGGCTGGAGCAAGG + Intergenic
1195572754 X:106414847-106414869 CAGTTTTCTGTGATGGTGATGGG - Intergenic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1202300853 Y:23412288-23412310 CAGTTTGGTGAAGTGGGGCTGGG + Intergenic
1202569958 Y:26258310-26258332 CAGTTTGGTGAAGTGGGGCTGGG - Intergenic