ID: 1070447834

View in Genome Browser
Species Human (GRCh38)
Location 10:76525032-76525054
Sequence GTGTCTGAGGGCACATTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070447827_1070447834 11 Left 1070447827 10:76524998-76525020 CCCTTCTGCAACCAATTGTCTCA 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1070447834 10:76525032-76525054 GTGTCTGAGGGCACATTCAATGG No data
1070447830_1070447834 0 Left 1070447830 10:76525009-76525031 CCAATTGTCTCAGGTCCTCTTCA 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1070447834 10:76525032-76525054 GTGTCTGAGGGCACATTCAATGG No data
1070447828_1070447834 10 Left 1070447828 10:76524999-76525021 CCTTCTGCAACCAATTGTCTCAG 0: 1
1: 0
2: 2
3: 12
4: 144
Right 1070447834 10:76525032-76525054 GTGTCTGAGGGCACATTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070447834 Original CRISPR GTGTCTGAGGGCACATTCAA TGG Intronic
No off target data available for this crispr