ID: 1070449566

View in Genome Browser
Species Human (GRCh38)
Location 10:76544268-76544290
Sequence GGGGGGAAAAAATTGCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070449566_1070449574 6 Left 1070449566 10:76544268-76544290 CCCATGGGCAATTTTTTCCCCCC 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1070449574 10:76544297-76544319 GAAGCATGTTAACTTACCACAGG No data
1070449566_1070449575 7 Left 1070449566 10:76544268-76544290 CCCATGGGCAATTTTTTCCCCCC 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1070449575 10:76544298-76544320 AAGCATGTTAACTTACCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070449566 Original CRISPR GGGGGGAAAAAATTGCCCAT GGG (reversed) Intronic
900096815 1:943130-943152 GGGGAGGAAAAATTCCCCTTAGG + Intronic
902182274 1:14698292-14698314 GAGGGGAATAAAGTGCCCAGGGG + Intronic
902387230 1:16082887-16082909 GAGGGGACGAAATTGACCATAGG - Intergenic
903779174 1:25810675-25810697 GGGAAGAGAAAATTGCCCCTAGG + Intronic
903944951 1:26956635-26956657 GGGAGGAAAAAATTGGAAATTGG + Intronic
904147165 1:28402265-28402287 GGGGGGAAAAAATTGGGAGTGGG + Intronic
904959145 1:34317175-34317197 GGGGGGACAGATTTGCCCCTTGG + Intergenic
909764315 1:79336331-79336353 GAGGGGAAAAAATAACCCAGAGG + Intergenic
910672606 1:89788234-89788256 GGGGGAAAAAAATTGCACAAAGG - Intronic
910987428 1:93019211-93019233 GGGGAGAAAAAATTACCTGTTGG + Intergenic
911683612 1:100747525-100747547 GAGGGGAAAAAGTTACCCATTGG - Intergenic
911970143 1:104424074-104424096 TGGGGGAAAAAATACCCCTTTGG + Intergenic
914814998 1:151056828-151056850 GTGGGGAAAATATTCCTCATGGG - Intronic
916062838 1:161112960-161112982 GGGGGGAAAAAATCTCTCAAAGG + Intronic
916091465 1:161310456-161310478 GCGGGGAAAAAAACTCCCATAGG - Intergenic
916681420 1:167108640-167108662 GGGGGGGAAAAATGGCAGATAGG + Intronic
916864636 1:168843140-168843162 GGGTGGAAATGATTACCCATAGG - Intergenic
918024556 1:180730630-180730652 TGGGGGAAAAATTTGCCAAAAGG - Intronic
919038229 1:192344844-192344866 AGGAGAAAAAAATTGCCCATCGG - Intronic
919995703 1:202747443-202747465 TGGGGGAAAATAGTGCCCAGAGG - Intronic
924086745 1:240459935-240459957 GGAAGGAAAAAATTGGCCATTGG + Intronic
1063345077 10:5304104-5304126 GGGGGGTTAGAATTGCCCCTGGG - Intergenic
1066257079 10:33690418-33690440 GTGGGGAAAAAACTGCCCCCTGG + Intergenic
1070449566 10:76544268-76544290 GGGGGGAAAAAATTGCCCATGGG - Intronic
1071379040 10:85039284-85039306 AGGATCAAAAAATTGCCCATTGG - Intergenic
1071382615 10:85083317-85083339 AGGGGGAAAAAAAAGCCCAGTGG - Intergenic
1072732505 10:97856199-97856221 AGGGTTAAAAAATTACCCATCGG - Intronic
1073800068 10:107032014-107032036 GGAGTGAAAAGAGTGCCCATAGG + Intronic
1073982862 10:109174718-109174740 GTGGGGAAAATATTGCCCTGTGG + Intergenic
1078227236 11:9403455-9403477 GGGGGGAAAAAATTGCCAAAGGG - Intronic
1085361403 11:75890997-75891019 GAGGACCAAAAATTGCCCATTGG + Intronic
1085995528 11:81908181-81908203 GGGGGGAAAATATAGACCTTTGG - Intergenic
1086443145 11:86848355-86848377 GAGAGGGAAAAATTGCCCACAGG + Intronic
1089513033 11:119012649-119012671 GGGGAGTAGAAATTGCCCAAAGG - Intronic
1092136898 12:6155709-6155731 GGGGGGAAAAATTTCCCTTTAGG + Intergenic
1093238626 12:16641494-16641516 TGGGGGAAAAAATTTCCAAGTGG - Intergenic
1093434821 12:19124538-19124560 TTGGGGAAATAATTGCCCTTAGG - Intergenic
1100239465 12:92696843-92696865 GGAGGGAAAAAATGTCCCACTGG + Intergenic
1100961692 12:99969154-99969176 GGGGGTAAAAAATTCCACACTGG + Intronic
1104499769 12:129273779-129273801 GGGAGGAAAAAACTGTCTATTGG + Intronic
1108514285 13:51183887-51183909 GAGGTTAAAAAAATGCCCATTGG - Intergenic
1110013559 13:70369949-70369971 GTGGGAAAAAAATTGCCCTGAGG - Intergenic
1112834797 13:103501137-103501159 GGTGGCAAAATATAGCCCATGGG - Intergenic
1115034046 14:28835989-28836011 GGCTGGAGAAAATTGCCCATGGG + Intergenic
1116157183 14:41220329-41220351 GGGATAAAAAAATTACCCATTGG + Intergenic
1116336269 14:43660711-43660733 GGGGGAAAAAAATCCCCCAAAGG + Intergenic
1117471792 14:56053761-56053783 GTGGGGAAGAAATTGACCAAGGG + Intergenic
1120519763 14:85512875-85512897 GGGGGGAAAAATTTGACAATGGG + Intergenic
1127337963 15:58008974-58008996 GGGTGGAGAAGATTGCCCTTGGG - Intronic
1127546144 15:59995625-59995647 GGGGGGAAAAAAATCACCACAGG + Intergenic
1128321070 15:66694711-66694733 GGGGGAAAAAATTTGCCCAGAGG + Intergenic
1128777083 15:70328850-70328872 AGGGGGAAAAGAGTGCCCAGGGG + Intergenic
1134800400 16:17079068-17079090 TGGGGGAAAACATAGCCCCTGGG + Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137976149 16:53033804-53033826 GGCTGGAAACAATTGGCCATAGG + Intergenic
1138792370 16:59920966-59920988 GAGGGTAAAAAATGGCCAATTGG - Intergenic
1139681348 16:68566502-68566524 GCAGGGAAAAAATTGTGCATGGG + Exonic
1141450474 16:84097051-84097073 GGAGAGAAAAAATTGCCAAAAGG + Intronic
1143591308 17:7887000-7887022 GGGAGATAAAAATTGCCCAGGGG - Intronic
1143644263 17:8219830-8219852 GAAGGGAATAAATTTCCCATTGG + Intergenic
1154503596 18:15009968-15009990 GGGGTGGAAAAACTGCCTATTGG + Intergenic
1159558587 18:69970526-69970548 GGGGGGAAAATACCTCCCATGGG - Intergenic
1160600023 18:80005326-80005348 GGGGGAGAAAAATTGCCCCCAGG + Intronic
1163273706 19:16269281-16269303 GAGGGGAAAAGAGGGCCCATTGG - Intergenic
1163626518 19:18393125-18393147 GTGGTGAAAACATTTCCCATCGG - Intronic
1164260168 19:23562539-23562561 GGGGGGAAAAGATTCTCCCTTGG - Intronic
1164773644 19:30833151-30833173 TGGGGAAAAAAATTCCCCAAAGG + Intergenic
1168495695 19:56847672-56847694 GAGGGGAAAAGATAACCCATAGG - Intergenic
925650675 2:6086158-6086180 CAGGGGAAAAAATCTCCCATTGG + Intergenic
926171844 2:10557693-10557715 GGCGGCAAACAATGGCCCATGGG - Intergenic
926449259 2:12982506-12982528 GGGGTTAAAACATTACCCATAGG - Intergenic
930165994 2:48204473-48204495 GGGGAGAAAAAGTTGACTATAGG + Intergenic
931537743 2:63297995-63298017 GGGGAGAAAAAATGGCCAAAGGG + Intronic
934139932 2:89036526-89036548 GAAGGGAACAAATGGCCCATAGG - Intergenic
934229308 2:90164025-90164047 GAAGGGAAGAAATGGCCCATAGG + Intergenic
936670156 2:114647257-114647279 GGGGAGAAAGAATTTCCCATTGG + Intronic
936800332 2:116258115-116258137 GGGGGGAAAAAATGTTTCATGGG - Intergenic
937786334 2:125903966-125903988 GGGGGAAATAAATCACCCATAGG - Intergenic
938502770 2:131840099-131840121 GGGGTGGAAAAACTGCCTATTGG + Intergenic
940040421 2:149354203-149354225 GGAGGGAAAAAAATGGCTATAGG - Intronic
940619810 2:156097412-156097434 TGGGGGAAATCATGGCCCATGGG - Intergenic
943911334 2:193571822-193571844 GGTGCCAAAAAATTGTCCATGGG - Intergenic
944417927 2:199497332-199497354 GGGGGAAAAAAAATACACATTGG + Intergenic
946260207 2:218483641-218483663 GGGGGGAAAAAAATGCTAAGGGG - Intronic
1168901877 20:1371661-1371683 GGGGGAAAAAAAAAGCCCTTTGG - Intronic
1172003964 20:31804458-31804480 TGGAGGAAAAGATTGCCCCTGGG - Intergenic
1172442724 20:34977498-34977520 GGGAGGTAAAAATAGCCCAGGGG + Intronic
1174773182 20:53320392-53320414 GGCAGGAAAATATTGCCCAGAGG - Intronic
1175270148 20:57728127-57728149 TGGGGGAAAAAAATGCCTGTGGG + Intergenic
1175514382 20:59559635-59559657 TGGGGGAAACAACTGCCTATGGG - Intergenic
1177020183 21:15845589-15845611 GGGGGAAAAAAATTGCACTTAGG - Intronic
1177096763 21:16845146-16845168 CAGGGCAAAAAATTGCCCATTGG + Intergenic
1177424476 21:20904781-20904803 AGGGTTAAAAAATTACCCATTGG + Intergenic
1178008719 21:28256760-28256782 AGGGGGACAAAATTGCACCTAGG - Intergenic
1178231930 21:30795715-30795737 GAAGGGAAAAAATTACCAATTGG + Intergenic
1178597391 21:33967143-33967165 AGGGGTAAAAAATTACCCAGTGG - Intergenic
1179649738 21:42800189-42800211 TGGGGTAAAAAACTGTCCATTGG + Intergenic
1180556797 22:16584811-16584833 GGGTGGAAAAAATGGCTCTTTGG - Intergenic
1184618855 22:45658584-45658606 GGGGGGAAAAAAGTGTATATAGG - Intergenic
949714139 3:6908919-6908941 GGGGAGAAAAAATTGCAAAAGGG - Intronic
951096044 3:18632553-18632575 GGGCTGAAAAAATTTCCTATTGG + Intergenic
954221562 3:49158131-49158153 GGGGGGCAAGGAGTGCCCATTGG + Intergenic
955245690 3:57222557-57222579 TTGGGGAAAAAATTGCTCATAGG - Intronic
956711738 3:72044243-72044265 TGGGGGACAAAATTACCCGTAGG + Intergenic
960466416 3:118001411-118001433 GAGGGGAAAAAAATGCCCTCAGG - Intergenic
967349606 3:188498145-188498167 GGGGGGAAAAAAAAGAACATAGG - Intronic
967661529 3:192116292-192116314 GGTGGAAAAATAGTGCCCATAGG + Intergenic
967919422 3:194603356-194603378 GGGGGGAGAAAAGCTCCCATGGG + Intronic
968714348 4:2143982-2144004 GGTGGTAATACATTGCCCATGGG + Intronic
970575165 4:17420013-17420035 AGGGGAAAAGAATTGCCCAAAGG - Intergenic
972223251 4:36980596-36980618 GGGGGAAAAAAAATGGCCGTTGG + Intergenic
977393364 4:96441942-96441964 GGGAGGGAAAAATAGCCCAAAGG + Intergenic
978417169 4:108488789-108488811 GTGGGGGAACTATTGCCCATGGG - Intergenic
979914593 4:126414374-126414396 AGGGTTAAAAAATTACCCATTGG + Intergenic
981047742 4:140281143-140281165 GTGGGGAACAAGTTGCCCAGAGG - Intronic
983467939 4:168118206-168118228 GGGGGAAAAAAATGGGCCCTTGG + Intronic
987520797 5:18980771-18980793 GGGTGAAAATAATTGCCTATAGG + Intergenic
987934650 5:24448597-24448619 GGGGGGAAGAGATTGGCCAATGG - Intergenic
990686053 5:58302406-58302428 ATGGGGACAAAATTGCCCACAGG - Intergenic
995554025 5:113309311-113309333 CGGGGTAAAAAATTACCTATTGG - Intronic
997838346 5:137215372-137215394 GGAGGGAAAAATCTGACCATAGG - Intronic
998394996 5:141812519-141812541 GGGGGGAAAAAACCACCCCTGGG + Intergenic
1005361724 6:25037190-25037212 AGGTGGAATAAATTGCCCACAGG + Intronic
1005933045 6:30498025-30498047 TGGGGGAACAAATATCCCATGGG + Intergenic
1007007191 6:38376131-38376153 GGGGGAAAAAAATGCCACATGGG - Intronic
1007090615 6:39182337-39182359 GGTAGCTAAAAATTGCCCATAGG - Intergenic
1007590108 6:43015912-43015934 GGGAGGCAAAAAATGCCCTTGGG - Intronic
1007808086 6:44465741-44465763 GAGGGGAAAAAATTGCTGTTGGG - Intergenic
1008201609 6:48597964-48597986 GGGTAGAAGAAATTGCCCAGAGG - Intergenic
1010740702 6:79500195-79500217 TGGGGAAAAAAATTACCCAAAGG - Intronic
1011899332 6:92272666-92272688 GGGGGGAAACAAATGACCACTGG - Intergenic
1015724692 6:136288346-136288368 GGAGGGAAAAAGTGGCCCCTCGG - Intronic
1016171968 6:141029048-141029070 GGGGGGAAAAAAAAGCAAATTGG - Intergenic
1016791259 6:148069333-148069355 AGGGGGAAATAATTGCCACTGGG - Intergenic
1023568436 7:41548268-41548290 GTGGGGAAAAAATAGCCATTGGG + Intergenic
1023582143 7:41694645-41694667 GGAGGGAAAAAATAGCACAGAGG - Intronic
1026165211 7:67903472-67903494 GTGGGGAAATGATTGCCCCTTGG + Intergenic
1028607001 7:92665893-92665915 AGGGTGAATAACTTGCCCATGGG - Intronic
1029327037 7:99818645-99818667 GGGGGAAAGAAGTTGCCCAGAGG + Intergenic
1029490544 7:100867875-100867897 AGGGGGCAAAAATTGACCCTGGG - Exonic
1032759802 7:134929365-134929387 AGGGGGAAAATACTGCGCATTGG - Intronic
1032990875 7:137393905-137393927 CAGGGAAAAAAATTGCACATAGG + Intronic
1034620522 7:152453220-152453242 GGGTGGAAAAAATGGCTCTTTGG + Intergenic
1034701467 7:153099740-153099762 TCGGGGCAAAAATTGCCCATCGG - Intergenic
1035315222 7:157993418-157993440 GGGAGGAAAAAAAAGCACATGGG - Intronic
1035437605 7:158870827-158870849 GAGGGTGAAAAATTACCCATTGG - Intronic
1038750986 8:30295681-30295703 GGGGAGAAAGAATTGGCCAGAGG - Intergenic
1039248418 8:35634637-35634659 GGGGGGAAAAAACAGACAATGGG + Intronic
1046126888 8:109921033-109921055 GGGGGGACAAAATTCACCACTGG + Intergenic
1046787517 8:118284163-118284185 GGTGGGCAAAAAGTGGCCATCGG - Intronic
1047567117 8:126057347-126057369 GTGGGGAAAAAATTTTCCGTGGG + Intergenic
1049559775 8:143304047-143304069 GGGTGAAAAAAATTGCCTTTGGG - Intergenic
1050353657 9:4763304-4763326 GGGGAGAAAGAGTTGCCCGTGGG - Intergenic
1052551542 9:29956573-29956595 GGGGGGAAATATTTGCACAAAGG - Intergenic
1052843826 9:33317116-33317138 CGGGGGAAAAAATTGCATATAGG + Intronic
1055803567 9:80067722-80067744 GTGGGGAAGAAAATGGCCATGGG + Intergenic
1058013826 9:100007805-100007827 GGGGGAAAAAAAAGGCCCAGTGG + Intronic
1059832744 9:118116771-118116793 TAGGGGAAAAAATTTCCCAGAGG - Intergenic
1061490667 9:130942183-130942205 GGGGTGGAAAAATAGTCCATGGG + Intergenic
1061875410 9:133541091-133541113 GAGGGGAAGAACTTGCCCAGTGG - Intronic
1187047213 X:15659128-15659150 TGGGGGAAAATATGGTCCATTGG + Intronic
1187259123 X:17668956-17668978 GAGGGGAAAAAATCACCCTTAGG + Intronic
1188607762 X:32053955-32053977 GGGGGGAATTAAATGCACATAGG + Intronic
1192429692 X:71103599-71103621 GGGAGGAAGAAACTGCCCAAAGG + Intergenic
1193131368 X:77923293-77923315 AGAGGGAAAAAATTGTGCATGGG - Intronic
1193825801 X:86224873-86224895 GTGGGGAAAAAATTGAGCAGGGG - Intronic
1196255817 X:113516840-113516862 GGGGGGAGAAAAAGGCCCATAGG - Intergenic
1200078919 X:153566030-153566052 GGGAGGAAGAAAGGGCCCATGGG + Intronic