ID: 1070449939

View in Genome Browser
Species Human (GRCh38)
Location 10:76547979-76548001
Sequence AGCCTGCTAAGTAAGGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070449935_1070449939 30 Left 1070449935 10:76547926-76547948 CCAAACTAGTCTTGCAGTTCAAG 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1070449939 10:76547979-76548001 AGCCTGCTAAGTAAGGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070449939 Original CRISPR AGCCTGCTAAGTAAGGGTGT GGG Intronic
No off target data available for this crispr