ID: 1070461213

View in Genome Browser
Species Human (GRCh38)
Location 10:76672295-76672317
Sequence CAGTCTCCTCACAGTGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070461213_1070461216 5 Left 1070461213 10:76672295-76672317 CCTATATCACTGTGAGGAGACTG No data
Right 1070461216 10:76672323-76672345 GACTGGCTGACAACAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070461213 Original CRISPR CAGTCTCCTCACAGTGATAT AGG (reversed) Intergenic
No off target data available for this crispr