ID: 1070464159

View in Genome Browser
Species Human (GRCh38)
Location 10:76703108-76703130
Sequence ACCACAATGAATAAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070464157_1070464159 28 Left 1070464157 10:76703057-76703079 CCATGGGCTAAAGGAGTCTGTGG No data
Right 1070464159 10:76703108-76703130 ACCACAATGAATAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070464159 Original CRISPR ACCACAATGAATAAAATTTC TGG Intergenic
No off target data available for this crispr