ID: 1070464269

View in Genome Browser
Species Human (GRCh38)
Location 10:76703820-76703842
Sequence GTGGCAAATACTGCCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070464269_1070464272 -1 Left 1070464269 10:76703820-76703842 CCAGGCCTGGCAGTATTTGCCAC No data
Right 1070464272 10:76703842-76703864 CAAGCTGATTCAAGAGCCCTTGG No data
1070464269_1070464273 0 Left 1070464269 10:76703820-76703842 CCAGGCCTGGCAGTATTTGCCAC No data
Right 1070464273 10:76703843-76703865 AAGCTGATTCAAGAGCCCTTGGG No data
1070464269_1070464276 16 Left 1070464269 10:76703820-76703842 CCAGGCCTGGCAGTATTTGCCAC No data
Right 1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070464269 Original CRISPR GTGGCAAATACTGCCAGGCC TGG (reversed) Intergenic
No off target data available for this crispr