ID: 1070464271

View in Genome Browser
Species Human (GRCh38)
Location 10:76703839-76703861
Sequence AGGGCTCTTGAATCAGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070464271_1070464276 -3 Left 1070464271 10:76703839-76703861 CCACAAGCTGATTCAAGAGCCCT No data
Right 1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG No data
1070464271_1070464280 30 Left 1070464271 10:76703839-76703861 CCACAAGCTGATTCAAGAGCCCT No data
Right 1070464280 10:76703892-76703914 AGCAGTACTTGCCTGGGCAGTGG No data
1070464271_1070464278 23 Left 1070464271 10:76703839-76703861 CCACAAGCTGATTCAAGAGCCCT No data
Right 1070464278 10:76703885-76703907 GTAGCTAAGCAGTACTTGCCTGG No data
1070464271_1070464279 24 Left 1070464271 10:76703839-76703861 CCACAAGCTGATTCAAGAGCCCT No data
Right 1070464279 10:76703886-76703908 TAGCTAAGCAGTACTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070464271 Original CRISPR AGGGCTCTTGAATCAGCTTG TGG (reversed) Intergenic
No off target data available for this crispr