ID: 1070464276

View in Genome Browser
Species Human (GRCh38)
Location 10:76703859-76703881
Sequence CCTTGGGCCTCGAGTGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070464271_1070464276 -3 Left 1070464271 10:76703839-76703861 CCACAAGCTGATTCAAGAGCCCT No data
Right 1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG No data
1070464269_1070464276 16 Left 1070464269 10:76703820-76703842 CCAGGCCTGGCAGTATTTGCCAC No data
Right 1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG No data
1070464270_1070464276 11 Left 1070464270 10:76703825-76703847 CCTGGCAGTATTTGCCACAAGCT No data
Right 1070464276 10:76703859-76703881 CCTTGGGCCTCGAGTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070464276 Original CRISPR CCTTGGGCCTCGAGTGAACA TGG Intergenic
No off target data available for this crispr