ID: 1070464974

View in Genome Browser
Species Human (GRCh38)
Location 10:76712084-76712106
Sequence CTTGCTCTGGTGGAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070464974_1070464982 11 Left 1070464974 10:76712084-76712106 CCCACCACCTCCACCAGAGCAAG No data
Right 1070464982 10:76712118-76712140 ATGGCTGAGAGACCTGCAGACGG 0: 7
1: 45
2: 110
3: 242
4: 504
1070464974_1070464980 -8 Left 1070464974 10:76712084-76712106 CCCACCACCTCCACCAGAGCAAG No data
Right 1070464980 10:76712099-76712121 AGAGCAAGTGCTTGTATCCATGG No data
1070464974_1070464984 24 Left 1070464974 10:76712084-76712106 CCCACCACCTCCACCAGAGCAAG No data
Right 1070464984 10:76712131-76712153 CTGCAGACGGCTCCCATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070464974 Original CRISPR CTTGCTCTGGTGGAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr