ID: 1070467048

View in Genome Browser
Species Human (GRCh38)
Location 10:76733924-76733946
Sequence ACCATTAGGGCACAGCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070467048_1070467059 23 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467059 10:76733970-76733992 CTTGGGCTTGAGCTGAGGTTTGG No data
1070467048_1070467061 25 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467061 10:76733972-76733994 TGGGCTTGAGCTGAGGTTTGGGG No data
1070467048_1070467057 6 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467057 10:76733953-76733975 CTGGGGGTCATCACACACTTGGG No data
1070467048_1070467058 18 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467058 10:76733965-76733987 ACACACTTGGGCTTGAGCTGAGG No data
1070467048_1070467056 5 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467056 10:76733952-76733974 ACTGGGGGTCATCACACACTTGG No data
1070467048_1070467060 24 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467060 10:76733971-76733993 TTGGGCTTGAGCTGAGGTTTGGG No data
1070467048_1070467054 -10 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467054 10:76733937-76733959 CCCTAATGGTCATAGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070467048 Original CRISPR ACCATTAGGGCACAGCTAAT GGG (reversed) Intergenic
No off target data available for this crispr