ID: 1070467054

View in Genome Browser
Species Human (GRCh38)
Location 10:76733937-76733959
Sequence CCCTAATGGTCATAGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070467048_1070467054 -10 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467054 10:76733937-76733959 CCCTAATGGTCATAGACTGGGGG No data
1070467045_1070467054 2 Left 1070467045 10:76733912-76733934 CCCTGGTGGAGGCCCATTAGCTG No data
Right 1070467054 10:76733937-76733959 CCCTAATGGTCATAGACTGGGGG No data
1070467046_1070467054 1 Left 1070467046 10:76733913-76733935 CCTGGTGGAGGCCCATTAGCTGT No data
Right 1070467054 10:76733937-76733959 CCCTAATGGTCATAGACTGGGGG No data
1070467042_1070467054 17 Left 1070467042 10:76733897-76733919 CCATCTGTTGGCATGCCCTGGTG No data
Right 1070467054 10:76733937-76733959 CCCTAATGGTCATAGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070467054 Original CRISPR CCCTAATGGTCATAGACTGG GGG Intergenic
No off target data available for this crispr