ID: 1070467057

View in Genome Browser
Species Human (GRCh38)
Location 10:76733953-76733975
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070467046_1070467057 17 Left 1070467046 10:76733913-76733935 CCTGGTGGAGGCCCATTAGCTGT No data
Right 1070467057 10:76733953-76733975 CTGGGGGTCATCACACACTTGGG No data
1070467048_1070467057 6 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467057 10:76733953-76733975 CTGGGGGTCATCACACACTTGGG No data
1070467055_1070467057 -8 Left 1070467055 10:76733938-76733960 CCTAATGGTCATAGACTGGGGGT No data
Right 1070467057 10:76733953-76733975 CTGGGGGTCATCACACACTTGGG No data
1070467045_1070467057 18 Left 1070467045 10:76733912-76733934 CCCTGGTGGAGGCCCATTAGCTG No data
Right 1070467057 10:76733953-76733975 CTGGGGGTCATCACACACTTGGG No data
1070467049_1070467057 5 Left 1070467049 10:76733925-76733947 CCATTAGCTGTGCCCTAATGGTC No data
Right 1070467057 10:76733953-76733975 CTGGGGGTCATCACACACTTGGG No data
1070467053_1070467057 -7 Left 1070467053 10:76733937-76733959 CCCTAATGGTCATAGACTGGGGG No data
Right 1070467057 10:76733953-76733975 CTGGGGGTCATCACACACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070467057 Original CRISPR CTGGGGGTCATCACACACTT GGG Intergenic
No off target data available for this crispr