ID: 1070467059

View in Genome Browser
Species Human (GRCh38)
Location 10:76733970-76733992
Sequence CTTGGGCTTGAGCTGAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070467049_1070467059 22 Left 1070467049 10:76733925-76733947 CCATTAGCTGTGCCCTAATGGTC No data
Right 1070467059 10:76733970-76733992 CTTGGGCTTGAGCTGAGGTTTGG No data
1070467053_1070467059 10 Left 1070467053 10:76733937-76733959 CCCTAATGGTCATAGACTGGGGG No data
Right 1070467059 10:76733970-76733992 CTTGGGCTTGAGCTGAGGTTTGG No data
1070467055_1070467059 9 Left 1070467055 10:76733938-76733960 CCTAATGGTCATAGACTGGGGGT No data
Right 1070467059 10:76733970-76733992 CTTGGGCTTGAGCTGAGGTTTGG No data
1070467048_1070467059 23 Left 1070467048 10:76733924-76733946 CCCATTAGCTGTGCCCTAATGGT No data
Right 1070467059 10:76733970-76733992 CTTGGGCTTGAGCTGAGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070467059 Original CRISPR CTTGGGCTTGAGCTGAGGTT TGG Intergenic
No off target data available for this crispr