ID: 1070467519

View in Genome Browser
Species Human (GRCh38)
Location 10:76738603-76738625
Sequence CAGGGAAAACACTCCAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070467519_1070467531 25 Left 1070467519 10:76738603-76738625 CCATGCTTGGAGTGTTTTCCCTG No data
Right 1070467531 10:76738651-76738673 TTCTCTGTAGTTTGTGCTGTGGG No data
1070467519_1070467534 28 Left 1070467519 10:76738603-76738625 CCATGCTTGGAGTGTTTTCCCTG No data
Right 1070467534 10:76738654-76738676 TCTGTAGTTTGTGCTGTGGGGGG No data
1070467519_1070467532 26 Left 1070467519 10:76738603-76738625 CCATGCTTGGAGTGTTTTCCCTG No data
Right 1070467532 10:76738652-76738674 TCTCTGTAGTTTGTGCTGTGGGG No data
1070467519_1070467523 -2 Left 1070467519 10:76738603-76738625 CCATGCTTGGAGTGTTTTCCCTG No data
Right 1070467523 10:76738624-76738646 TGTGGTCCTCTCTCTGTCCCAGG No data
1070467519_1070467530 24 Left 1070467519 10:76738603-76738625 CCATGCTTGGAGTGTTTTCCCTG No data
Right 1070467530 10:76738650-76738672 CTTCTCTGTAGTTTGTGCTGTGG No data
1070467519_1070467533 27 Left 1070467519 10:76738603-76738625 CCATGCTTGGAGTGTTTTCCCTG No data
Right 1070467533 10:76738653-76738675 CTCTGTAGTTTGTGCTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070467519 Original CRISPR CAGGGAAAACACTCCAAGCA TGG (reversed) Intergenic
No off target data available for this crispr