ID: 1070468419

View in Genome Browser
Species Human (GRCh38)
Location 10:76749757-76749779
Sequence CTGTGTCTCTGACAAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070468413_1070468419 11 Left 1070468413 10:76749723-76749745 CCAAAAAAAAAAAAAAAACCAAA 0: 28
1: 479
2: 15681
3: 23596
4: 46815
Right 1070468419 10:76749757-76749779 CTGTGTCTCTGACAAGGGGAAGG No data
1070468414_1070468419 -7 Left 1070468414 10:76749741-76749763 CCAAAAAAAAAATCTCCTGTGTC No data
Right 1070468419 10:76749757-76749779 CTGTGTCTCTGACAAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070468419 Original CRISPR CTGTGTCTCTGACAAGGGGA AGG Intergenic
No off target data available for this crispr