ID: 1070469240

View in Genome Browser
Species Human (GRCh38)
Location 10:76761964-76761986
Sequence TTGTGGACAAGTATCGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070469240_1070469247 10 Left 1070469240 10:76761964-76761986 CCCTGCTCGATACTTGTCCACAA No data
Right 1070469247 10:76761997-76762019 AAAACTTGGTCAAATGCCATGGG No data
1070469240_1070469248 20 Left 1070469240 10:76761964-76761986 CCCTGCTCGATACTTGTCCACAA No data
Right 1070469248 10:76762007-76762029 CAAATGCCATGGGAAAATCCAGG No data
1070469240_1070469245 -4 Left 1070469240 10:76761964-76761986 CCCTGCTCGATACTTGTCCACAA No data
Right 1070469245 10:76761983-76762005 ACAAAGGGATTTTGAAAACTTGG No data
1070469240_1070469246 9 Left 1070469240 10:76761964-76761986 CCCTGCTCGATACTTGTCCACAA No data
Right 1070469246 10:76761996-76762018 GAAAACTTGGTCAAATGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070469240 Original CRISPR TTGTGGACAAGTATCGAGCA GGG (reversed) Intergenic
No off target data available for this crispr