ID: 1070471017

View in Genome Browser
Species Human (GRCh38)
Location 10:76779588-76779610
Sequence TCAGGGACCCAGAAATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070471017_1070471025 5 Left 1070471017 10:76779588-76779610 CCTTGAGATTTCTGGGTCCCTGA No data
Right 1070471025 10:76779616-76779638 GGGAAAGGTATTCAGACCAGGGG No data
1070471017_1070471020 -10 Left 1070471017 10:76779588-76779610 CCTTGAGATTTCTGGGTCCCTGA No data
Right 1070471020 10:76779601-76779623 GGGTCCCTGAAAACAGGGAAAGG No data
1070471017_1070471023 3 Left 1070471017 10:76779588-76779610 CCTTGAGATTTCTGGGTCCCTGA No data
Right 1070471023 10:76779614-76779636 CAGGGAAAGGTATTCAGACCAGG No data
1070471017_1070471024 4 Left 1070471017 10:76779588-76779610 CCTTGAGATTTCTGGGTCCCTGA No data
Right 1070471024 10:76779615-76779637 AGGGAAAGGTATTCAGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070471017 Original CRISPR TCAGGGACCCAGAAATCTCA AGG (reversed) Intergenic
No off target data available for this crispr