ID: 1070471020

View in Genome Browser
Species Human (GRCh38)
Location 10:76779601-76779623
Sequence GGGTCCCTGAAAACAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070471017_1070471020 -10 Left 1070471017 10:76779588-76779610 CCTTGAGATTTCTGGGTCCCTGA No data
Right 1070471020 10:76779601-76779623 GGGTCCCTGAAAACAGGGAAAGG No data
1070471013_1070471020 24 Left 1070471013 10:76779554-76779576 CCTGGTGGTGGAGTAGGTCAGGG No data
Right 1070471020 10:76779601-76779623 GGGTCCCTGAAAACAGGGAAAGG No data
1070471011_1070471020 25 Left 1070471011 10:76779553-76779575 CCCTGGTGGTGGAGTAGGTCAGG No data
Right 1070471020 10:76779601-76779623 GGGTCCCTGAAAACAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070471020 Original CRISPR GGGTCCCTGAAAACAGGGAA AGG Intergenic
No off target data available for this crispr