ID: 1070471023

View in Genome Browser
Species Human (GRCh38)
Location 10:76779614-76779636
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070471017_1070471023 3 Left 1070471017 10:76779588-76779610 CCTTGAGATTTCTGGGTCCCTGA No data
Right 1070471023 10:76779614-76779636 CAGGGAAAGGTATTCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070471023 Original CRISPR CAGGGAAAGGTATTCAGACC AGG Intergenic
No off target data available for this crispr