ID: 1070471025

View in Genome Browser
Species Human (GRCh38)
Location 10:76779616-76779638
Sequence GGGAAAGGTATTCAGACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070471017_1070471025 5 Left 1070471017 10:76779588-76779610 CCTTGAGATTTCTGGGTCCCTGA No data
Right 1070471025 10:76779616-76779638 GGGAAAGGTATTCAGACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070471025 Original CRISPR GGGAAAGGTATTCAGACCAG GGG Intergenic
No off target data available for this crispr