ID: 1070471408

View in Genome Browser
Species Human (GRCh38)
Location 10:76783858-76783880
Sequence CTCAGATTCTTGCTGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070471408_1070471414 2 Left 1070471408 10:76783858-76783880 CCAGCAGCCAGCAAGAATCTGAG No data
Right 1070471414 10:76783883-76783905 CCTTAGTGCAACTGGACCCCAGG No data
1070471408_1070471411 -6 Left 1070471408 10:76783858-76783880 CCAGCAGCCAGCAAGAATCTGAG No data
Right 1070471411 10:76783875-76783897 TCTGAGGCCCTTAGTGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070471408 Original CRISPR CTCAGATTCTTGCTGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr