ID: 1070476421

View in Genome Browser
Species Human (GRCh38)
Location 10:76833772-76833794
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070476421_1070476427 3 Left 1070476421 10:76833772-76833794 CCTTCTGCCTCCCTCTCCATTGT No data
Right 1070476427 10:76833798-76833820 CATTGCTGTAAGTAGAGTTGAGG No data
1070476421_1070476428 16 Left 1070476421 10:76833772-76833794 CCTTCTGCCTCCCTCTCCATTGT No data
Right 1070476428 10:76833811-76833833 AGAGTTGAGGTTTTAGATGCTGG No data
1070476421_1070476430 25 Left 1070476421 10:76833772-76833794 CCTTCTGCCTCCCTCTCCATTGT No data
Right 1070476430 10:76833820-76833842 GTTTTAGATGCTGGCTTTATGGG No data
1070476421_1070476429 24 Left 1070476421 10:76833772-76833794 CCTTCTGCCTCCCTCTCCATTGT No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070476421 Original CRISPR ACAATGGAGAGGGAGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr