ID: 1070476425

View in Genome Browser
Species Human (GRCh38)
Location 10:76833788-76833810
Sequence ACTTACAGCAATGGAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070476425_1070476428 0 Left 1070476425 10:76833788-76833810 CCATTGTCTCCATTGCTGTAAGT No data
Right 1070476428 10:76833811-76833833 AGAGTTGAGGTTTTAGATGCTGG No data
1070476425_1070476429 8 Left 1070476425 10:76833788-76833810 CCATTGTCTCCATTGCTGTAAGT No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data
1070476425_1070476430 9 Left 1070476425 10:76833788-76833810 CCATTGTCTCCATTGCTGTAAGT No data
Right 1070476430 10:76833820-76833842 GTTTTAGATGCTGGCTTTATGGG No data
1070476425_1070476431 21 Left 1070476425 10:76833788-76833810 CCATTGTCTCCATTGCTGTAAGT No data
Right 1070476431 10:76833832-76833854 GGCTTTATGGGACCTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070476425 Original CRISPR ACTTACAGCAATGGAGACAA TGG (reversed) Intergenic
No off target data available for this crispr