ID: 1070476427

View in Genome Browser
Species Human (GRCh38)
Location 10:76833798-76833820
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070476424_1070476427 -8 Left 1070476424 10:76833783-76833805 CCTCTCCATTGTCTCCATTGCTG No data
Right 1070476427 10:76833798-76833820 CATTGCTGTAAGTAGAGTTGAGG No data
1070476423_1070476427 -7 Left 1070476423 10:76833782-76833804 CCCTCTCCATTGTCTCCATTGCT No data
Right 1070476427 10:76833798-76833820 CATTGCTGTAAGTAGAGTTGAGG No data
1070476421_1070476427 3 Left 1070476421 10:76833772-76833794 CCTTCTGCCTCCCTCTCCATTGT No data
Right 1070476427 10:76833798-76833820 CATTGCTGTAAGTAGAGTTGAGG No data
1070476422_1070476427 -4 Left 1070476422 10:76833779-76833801 CCTCCCTCTCCATTGTCTCCATT No data
Right 1070476427 10:76833798-76833820 CATTGCTGTAAGTAGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070476427 Original CRISPR CATTGCTGTAAGTAGAGTTG AGG Intergenic