ID: 1070476429

View in Genome Browser
Species Human (GRCh38)
Location 10:76833819-76833841
Sequence GGTTTTAGATGCTGGCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070476421_1070476429 24 Left 1070476421 10:76833772-76833794 CCTTCTGCCTCCCTCTCCATTGT No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data
1070476422_1070476429 17 Left 1070476422 10:76833779-76833801 CCTCCCTCTCCATTGTCTCCATT No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data
1070476424_1070476429 13 Left 1070476424 10:76833783-76833805 CCTCTCCATTGTCTCCATTGCTG No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data
1070476426_1070476429 -1 Left 1070476426 10:76833797-76833819 CCATTGCTGTAAGTAGAGTTGAG No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data
1070476423_1070476429 14 Left 1070476423 10:76833782-76833804 CCCTCTCCATTGTCTCCATTGCT No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data
1070476425_1070476429 8 Left 1070476425 10:76833788-76833810 CCATTGTCTCCATTGCTGTAAGT No data
Right 1070476429 10:76833819-76833841 GGTTTTAGATGCTGGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070476429 Original CRISPR GGTTTTAGATGCTGGCTTTA TGG Intergenic
No off target data available for this crispr